Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000011 Similarity: 0.952 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA000011
Gene: A1CF
MFE: -29.807
ENS: 0.918
Length: 165.
Predicted Ligands:
cobalamin - 9/20
FMN - 6/20
SAM - 2/20
 RS: URS00023330D4_1797911
MFE: -39.
Ligand: cobalamin
Species: Desulfobacula sp. RIFOXYA12_FULL_46_16 Cobalamin riboswitch
 RS: URS0000DB3239_262324
MFE: -69.150
Ligand: FMN
Species: Lysobacter gummosus FMN riboswitch (RFN element)
 RS: URS000231D69B_1797289
MFE: -64.761
Ligand: cobalamin
Species: Armatimonadetes bacterium RBG_19FT_COMBO_69_19 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000011 URS00023330D4_1797911 URS0000DB3239_262324 URS000231D69B_1797289
Length 165. 163. 165. 164.
Similarity - 0.952 0.952 0.951
Ensemble Norm 0.918 - - -
MFE -29.807 -39. -69.150 -64.761
Ligands - cobalamin FMN cobalamin
Gene A1CF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 5. 2.
Length SE - 4. 0. 1.
Lev Distance - 49. 62. 63.
UBS 14. 12. 14. 14.
BS 0. 0. 1. 0.
ILL 2. 3. 3. 3.
ILR 4. 4. 3. 4.
H 3. 3. 4. 3.
BL 4. 5. 5. 5.
BR 6. 3. 6. 6.
UN 0.121 0.117 0.109 0.128

Sequences

Field Description
UTR seq + 25 uuugauaugacgauuagagcauaacccgagugacacguugaauucgccauaaucaaggaaaccuuuuccggguggggaucucugaaauuacucagugagcaacccuaauuaaccugauuuuuugcugauaaucacucucaATGGAAGCAGTGTGTCTGGGCACAT
UTR dot + 25 (((((((((.(((.(..(((…………….)))..).))).)))).)))))………..(((((((((.((.((((……)))).))….))))…..)))))……((((((((..(((((((….)).).))))))))..))))…
RS 1 seq CAGGCGCAGAUAAAAGGGAAUCCUGUGAGAAUCAGGAACGGACCCGCCGCUGUAACCGGGGAUGAAGGUCACAGAUACCACUGUUGAUAAGCUGAUGAACGGGAAGGUGUGACCCGUAAAAUGAUCCGGAAGCCAGAAAACCUGCCUGAGUGUUUGGUCGUGU
RS 1 dot ..((.((((……(((..(((((…….)))))…..)))….))))..))………((((((….(((.(((((.((……)).)))))…)))))))))……((((.(((((.(((((………))).)).)))))))))..
RS 2 seq UAACGUCUUCAGGGCGGGGCGAAACUCCCCACCGGCGGUAGGCGCGGCAACGCGCGAGCCCGCGAGCGCCUGCGGAUCCCGGCCUCGGCCGCGCGAACCGCAGGGUCAGCAGAUCCGGUCCAAUGCCGGAGCCGACGGUCACAGUCCGGAUGAAAGAAGACGGCU
RS 2 dot …(((((((..((.((((.(…).)))).))…(((..(((((….)))))..))).((..((.(((((((.(((((((….)))).).)).)))))))))..))..((((((.(….((((…….))))….).))))))….)))))))…
RS 3 seq UACGAUCUCACGGGUGCAGGUGGAGGGAAGUCCGGUGCGAUUCCGGCGCGGUCCCGCCGCUGUCACCGGUAAGGAUCCCCGAUCAGGCCACUGGGUUCGUCCGGGAAGGCCGGGGACUCCGAUGAACCGGGAGCCAGAAGACCUGCCUGCCCCACUCGCCACAC
RS 3 dot ………((.((((..(((((.((((.((((((…….)))).))..)))).)))))..)))).))..((((((((…..((((.((((……))))…))))))))).)))…((…(((((.(((…..))).)).)))…))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table