Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000069 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA000069
Gene: A2ML1
MFE: -24.949
ENS: 0.725
Length: 123.
Predicted Ligands:
FMN - 14/20
SAM - 2/20
TPP - 2/20
 RS: URS0000C11025_1472719
MFE: -38.362
Ligand: SAM
Species: Paenibacillus sp. P1XP2 SAM riboswitch (S box leader)
 RS: URS0000D97942_1801814
MFE: -32.571
Ligand: FMN
Species: Omnitrophica bacterium GWA2_41_15 FMN riboswitch (RFN element)
 RS: URS0000AB7AB3_293826
MFE: -28.475
Ligand: FMN
Species: Alkaliphilus metalliredigens QYMF FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000069 URS0000C11025_1472719 URS0000D97942_1801814 URS0000AB7AB3_293826
Length 123. 124. 123. 122.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0.725 - - -
MFE -24.949 -38.362 -32.571 -28.475
Ligands - SAM FMN FMN
Gene A2ML1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.005 5.027
Length SE - 1. 0. 1.
Lev Distance - 39. 41. 39.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 2. 1. 1. 1.
H 5. 4. 4. 4.
BL 1. 1. 2. 0.
BR 1. 2. 1. 2.
UN 0.163 0.185 0.236 0.328

Sequences

Field Description
UTR seq + 25 aucagucaucacugcacacccuaccuggaauuaguauauaaagcuacgcggagcgaucucugccccugacccuggaaaaaucugucucacccacaaagATGTTAATAGGGAAAGGAAGTTTGG
UTR dot + 25 ..((((….))))…..((…..))…((((…….)))).((((((….)))))).(((..(((((..((.((((………….)))).))..)))))..)))……..
RS 1 seq AUCUUAUCAAGAGCAGGUGGAGGGACUAGCCCAAUGAAACCCGGCAACCGGCGCGAAUGCGCACGGUGCUAAUUCUUGCAGGAACGUGAAGCUGCUUUGCGCAGCGGUUUCUGACAGAUGAGAG
RS 1 dot …(((((…….))))).(((…..)))……….(((.((((((((….)))).)))))))…(((..(((((((…..(((((…..))))).)))))))..)))……
RS 2 seq UAUAAUCUUCGGGAGAGGGUGAAAUUCCCCACCGGCGGUAUAGUCCGCGAGCUCUCAUAAAAGAGGGCAGACUUGGCGCGAUUCCAGGACCGAUUGUGAAAGGCUAGAUGGGAGAAGAUAAGU
RS 2 dot ………(((..(.(((…….)))).)))((((……))))..((((((……))))))((.(((..(((((((……..)))))))..)))))………………
RS 3 seq UAAAAUCUUCAGGGCAGGGUGAAAUUCCCGACCGGCGGUUAGAGUCCGCGACUCAACAUAAUGUUGAUUGAUCUGGUGAAAUUCCAGUACCGACAGUAAAGUCUGGAUGGAAGAAGAGCAAG
RS 3 dot …………((..(((…….)))..)).((((…….))))…((((((…))))))…………..(((((…(((((……))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table