Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000079 Similarity: 0.951 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA000079
Gene: AAAS
MFE: -62.566
ENS: 0.803
Length: 188.
Predicted Ligands:
cobalamin - 12/20
TPP - 4/20
molybdenum - 2/20
 RS: URS0000D79814_1918948
MFE: -51.558
Ligand: TPP
Species: Solemya velesiana gill symbiont TPP riboswitch (THI element)
 RS: URS0000AB5604_658429
MFE: -71.124
Ligand: TPP
Species: Geomyces destructans 20631-21 TPP riboswitch (THI element)
 RS: URS0002331C16_591159
MFE: -85.450
Ligand: cobalamin
Species: Streptomyces viridochromogenes DSM 40736 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000079 URS0000D79814_1918948 URS0000AB5604_658429 URS0002331C16_591159
Length 188. 188. 189. 190.
Similarity - 0.951 0.951 0.951
Ensemble Norm 0.803 - - -
MFE -62.566 -51.558 -71.124 -85.450
Ligands - TPP TPP cobalamin
Gene AAAS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 15.001 19.002
Length SE - 0. 1. 4.
Lev Distance - 62. 55. 48.
UBS 14. 15. 11. 16.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 4.
ILR 5. 6. 6. 7.
H 4. 3. 2. 4.
BL 5. 6. 4. 4.
BR 2. 3. 2. 5.
UN 0.106 0.101 0.132 0.063

Sequences

Field Description
UTR seq + 25 cccguuagucuuuucuucacuuccguugaguuccgccucgccguuugucccuugcgguacccguccgcauacgaaucuagcccgggaaccgaguugcgggagugcggucugugccguuccggccaggaguuugccgacugcagacguccugcgaaccggcaagATGTGCTCTCTGGGGTTGTTCCCTC
UTR dot + 25 …………..((.(((((((((((.(((((.(…((.((((((….(((((…….))))).))))))…))..))))))))….))))))))).)).(((.((((…)))))))((((((((((..(((((…..)))))…))))))…..))))…((((….))))..
RS 1 seq ACACACAGCUAGGGGUGCCCACAAACCAAUUGAGCCGUCUACUUUUUUCAAGGCAAUGCGCGUCGUUUUCGAUCAGUACAAAAACGAUGCAACAGCGAAUUGAAUCAAAAGAGAGACUCAAGGGCUGAGACAAACCCUUCGAACCUGACCCGGUUAACACCGGCGUAGGGAAGCUGACCGCAGAUGCG
RS 1 dot ……..(.((((((((((………(((((.(.(((.((((((((((..(..((.((((((((((.(…….).))))))))))..))..)..)))))..))))))))).)))))))))……..)))))).)..((((..(((((….)))))..))))………(((….)))
RS 2 seq UAAAAGCAUGACGGGUGUCCAGGCCCUCAAUUGUCUCUUCCAGCUCAGCUCUGGAGGUUGUGGUCUCACGACCCUCCCUUCAUCGCGAGUCAGAGCUGGAAGAGGUAGUUGAUGACCUGGUUCUGAGAUUAUACCGUAUGAACUUGAUCUAGACAAUUCUAGCGCAUAAGGACAUGCUUCCCCCUCCCC
RS 2 dot ………….((((((((((.(.((((((((((((((((((((.((((((((((..(.((((….)))))..))))))….))))..)))))))))))))))))))).).)))))……….)))))(((((..((((..(((((….)))))….))))..)))))…………
RS 3 seq UGAUAGCUUGCCGAGGCCAGUCGAACCCAUGUACGUGGGUCAGGGAAUCCGGUGCGAAUCCGGAACUGACGCGCAGCGGUGAGGGGGACGGGCGGGGCCUCGGCCACUGGACGGCGCGCGAGUCGUCCGGGAAGGCGUCCCGCACCGGGUGAACCCGAGUCCGAAGACCUGCUGGCGGCCCCCGCGGCCG
RS 3 dot ………(((((((((.((((..(((…((((((.(((((….(((((…….))))).))))).)))….)))..)))..))).)..)))))))))..(((((((((……)))))))))(..((((((.((.((((((….)))).)).))..)))..)))..)((((…..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table