Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000177 Similarity: 0.950 Similarity: 0.946 Similarity: 0.945
UTR: 5HSAA000177
Gene: AASDH
MFE: -43.142
ENS: 0.
Length: 178.
Predicted Ligands:
cobalamin - 10/20
lysine - 5/20
TPP - 2/20
RS: URS000231AC1E_1635260
MFE: -61.936
Ligand: cobalamin
Species: Thermotoga sp. 50_1627 Cobalamin riboswitch
RS: URS0002311FA7_1851544
MFE: -63.617
Ligand: cobalamin
Species: Orrella dioscoreae Cobalamin riboswitch
RS: URS0002331E13_1049986
MFE: -38.303
Ligand: cobalamin
Species: Leptospira weilii str. Ecochallenge Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000177 URS000231AC1E_1635260 URS0002311FA7_1851544 URS0002331E13_1049986
Length 178. 178. 178. 178.
Similarity - 0.950 0.946 0.945
Ensemble Norm 0. - - -
MFE -43.142 -61.936 -63.617 -38.303
Ligands - cobalamin cobalamin cobalamin
Gene AASDH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.020 5.001 9.004
Length SE - 0. 0. 0.
Lev Distance - 62. 70. 69.
UBS 14. 14. 15. 12.
BS 0. 0. 0. 0.
ILL 4. 3. 5. 4.
ILR 6. 4. 6. 6.
H 4. 4. 3. 4.
BL 4. 6. 3. 3.
BR 3. 3. 4. 1.
UN 0.022 0.163 0.045 0.084

Sequences

Field Description
UTR seq + 25 gggauagcuuuacggcuucugggagcugcugcuucgcugugagaaguauccgcgacgagcuauccgggaaagggccgaaugcgaucaaaccuaauccgcgagacuugcuaagguucugugcuacaaauugauguuuagauaaacuucagugaaATGACTCTTCAGGAATTGGTGCATA
UTR dot + 25 .(((((((((..((((((((.(.(((………))).).)))))…)))….))))))))).(((..(((..((……))…)))..)))..((.((((….))))))(((((..((((((((.((((….)))).)))))………………)))..)))))
RS 1 seq AAAAGCGAGGCGUCGGAGGGUACCGAAGAGGUUCAAAAGGGAAGCCGGUGAAAGUCCGGCGCGGGGACGCCACCGUAACCGGGGACGAAACCCACAAGAGCCACUGGUGUAAGCCGGGAAGGCGUGGGGAGUAGGAUGAUCCGGAAGCCGGGAGACCUGCCCUUCGACGAAAUCACCA
RS 1 dot ………((((((((…(((((….(.(((……))).))))))….)))))))).(((.((((.(((….))))).))…)))……(((.(((((….)))))…))).(((((.(((((.(..(((((…)))))..)))))).)))))…………
RS 2 seq CCGGCAGCAGUUCAUGACGGCGCGCCUCGCAUCGGGAAAGUUCAAACGGGAAACAGGAAGAGGCCGCCCGCCGCGUCGUCGCGCCGCAACGUCUCCAGCCUGUGCUGCCCCCGCAACGGUCACUCCGCGCGCUGCCGCCGCGGACGAGCCCGAUACCGGCCGGUUCACCACGGAGGAU
RS 2 dot ..((((((((((…((((((((((..(((..((((……….(((…………..)))))))..)))..).))))))…..)))…)))…))))))).(((…(((.(.(((((((.((….)))))))).).).)))….)))(((……..)))…..
RS 3 seq ACUCUGGAAUACAAACUUGUUCAUCCUCGUAAAAAGGAAGGGAAUCCGGUUUAAGUCCGGAGCUGAACCCGCAGCUGUAAUCGCCAACCAAGGUUUCGCAAAAAUACCACUGCUUUAAACGCGGGAAGGGCGCGAAGUCGGCGAGAGCCAGAAGACCUAACAAGUGAAACAAACUGAU
RS 3 dot .(((((((….(((((.((((.((((…….))))…))))..)))))…)))))))(((……)))((((..(((((……((((((((…….((.((((…….))))…))..)))))))))))))..)).))………..(((…….)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table