Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000187 Similarity: 0.973 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA000187
Gene: AASDHPPT_0
MFE: -21.419
ENS: 0.966
Length: 113.
Predicted Ligands:
glycine - 6/20
TPP - 4/20
SAM - 4/20
RS: URS0000C096AD_1655635
MFE: -39.776
Ligand: TPP
Species: Verrucomicrobia subdivision 6 bacterium BACL9 MAG-120924-bin69 TPP riboswitch (THI element)
RS: URS0000C30537_1549748
MFE: -32.885
Ligand: glycine
Species: Kiloniella litopenaei Glycine riboswitch
RS: URS0000ABA83B_278197
MFE: -20.822
Ligand: TPP
Species: Pediococcus pentosaceus ATCC 25745 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000187 URS0000C096AD_1655635 URS0000C30537_1549748 URS0000ABA83B_278197
Length 113. 112. 111. 112.
Similarity - 0.973 0.970 0.970
Ensemble Norm 0.966 - - -
MFE -21.419 -39.776 -32.885 -20.822
Ligands - TPP glycine TPP
Gene AASDHPPT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 5.001 8.032
Length SE - 1. 4. 1.
Lev Distance - 33. 34. 37.
UBS 7. 8. 6. 6.
BS 0. 0. 0. 0.
ILL 5. 4. 4. 3.
ILR 3. 2. 4. 2.
H 2. 2. 1. 1.
BL 0. 1. 1. 0.
BR 1. 3. 1. 2.
UN 0.080 0.107 0.054 0.259

Sequences

Field Description
UTR seq + 25 aauaggagagacgucauaaggcaauacuagaauaacugccaaaugaauuacauaaacaauacuguuuuggaaaaaggcuggucgucugATGGTTTTCCCTGCCAAACGGTTCT
UTR dot + 25 ….(((((..((((…((((…(((((..(…..(((((………………….)))))….)..))))).))))))))..)))))..(((….)))…
RS 1 seq UCUUGUCCCUCGGGGAGUCCAGACGGCUGGGCUGAGAGUCGGGAACCACGGUCCCGAGACCCUAUAACCUGAUGCGGAUCAUGCCGCCGGAGGGAACGGGCGAACCCUUUUC
RS 1 dot …..((((((.((………((((..(((((…((((((……((((….))))……)))))).))).))..)))))).))))))..(((….)))…..
RS 2 seq AUACCUCUCGCGGGAGAGAUUGCCGUAAAGUUUCUUAAGCGAAACAAUACGGGCAGCGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCACAUGGACCGCAAGAGGCAG
RS 2 dot …(((((.((((…….((((….(((((((…(((……..(((……)))……….)))…)))))))….))))……)))).)))))…
RS 3 seq AUUUUGUAACAGGGGUGCUGGGCUUUACCUGGCUGAGAUUAAAACUAAAUGGUUUUUGACCCUCGAACCUGAUAUGGAUAAUGCCAGCGCAGGAAGACUCAAUUGUAAUAUU
RS 3 dot ………………(((((((..((((((((..((((………(((((………)))))………))))..)))).))))))).))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table