Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000178 Similarity: 0.942 Similarity: 0.939 Similarity: 0.938
UTR: 5HSAA000178
Gene: AASDH_0
MFE: -41.821
ENS: 0.830
Length: 190.
Predicted Ligands:
cobalamin - 15/20
TPP - 2/20
SAM - 2/20
 RS: URS0002323C94_44010
MFE: -71.215
Ligand: cobalamin
Species: Mycobacterium conspicuum Cobalamin riboswitch
 RS: URS0000AB239B_467200
MFE: -76.075
Ligand: TPP
Species: Streptomyces griseoflavus Tu4000 TPP riboswitch (THI element)
 RS: URS0002316490_935850
MFE: -65.829
Ligand: cobalamin
Species: Paracoccus sp. J56 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000178 URS0002323C94_44010 URS0000AB239B_467200 URS0002316490_935850
Length 190. 191. 190. 191.
Similarity - 0.942 0.939 0.938
Ensemble Norm 0.830 - - -
MFE -41.821 -71.215 -76.075 -65.829
Ligands - cobalamin TPP cobalamin
Gene AASDH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 20. 10.004
Length SE - 1. 0. 1.
Lev Distance - 71. 70. 77.
UBS 16. 14. 15. 15.
BS 0. 0. 0. 0.
ILL 3. 4. 5. 3.
ILR 7. 5. 4. 5.
H 3. 4. 4. 5.
BL 4. 5. 3. 5.
BR 3. 3. 5. 3.
UN 0.032 0.037 0.047 0.094

Sequences

Field Description
UTR seq + 25 uucugggagcugcugcuucgcugugagaaguauccgcgacgagcuauccgggaaagggccgaaugcgaucaaaccuaauccgcgagacuugcuaaaauucuccaagucccggcugcuuauguaccuaucgagccagauucaccaccgucauuaucaacucauuuuATGACTCTTCAGGAATTGGTGCATA
UTR dot + 25 (((((((((((((((((((…….))))))…))….)))).)))))))…((((((..(.(..((……..(((.(.((((((………..))))))))))…….))..))..))).)))..((.((((((((((((…………..)))))……))…))))).)).
RS 1 seq CAUCGAGCGAAGCGUGUUAGGAGGCUUCGCAAGAGGGAACCCGGUGCAAGUCCGGGACUGUCCCGCAGCGGUAAGCAGGAACGACCGCCGUCAAAAGCACUGGUCACCAGACUGGGAAGCGACGGCCAUUAGGAGCACCACUGGAGUGCGCGCCUGCGAGUCCGAAGACCUGCCAGCAGUACCGGGCGCGC
RS 1 dot ..((..(((((((.(……).)))))))..))((((.(((((…….)))))….)))).(((.(((..((……….((((((….((.((((((….))))))…))))))))……..))))).)))….(((((((((((.(((….))).)))……….))))))))
RS 2 seq UUUUGUACACGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUCCGUCCCAGCCAUGUUUCACAUGAAACGUCACCGAAGUCGAGUGAUGUUUCACACGGAACGCCGGCAGACGGAAACCGCUGCGUCGACCGCUGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUAGGUCUCAUGACCAA
RS 2 dot ….((.(((((…(((((((….)))))))……))).)))).((((((…(((.((((((…(((((((((((((….)).)))))))))))…))))))..))).)))))).(((.((((((((…((…(((((….)))))…)))))))))).).)).((((….))))..
RS 3 seq GCUUACUGAUGGGGUCAUGGUGAAUCCGGCCCCGGCCGGACGAAGAAGAGGGAAGCCGGUGAAAAUCCGGCACUGCCCCCGCAGCUGUAAGCGGCGAGCGACGCUGGAACACCACUGAGGCCCUGGCUUCGGGAAGGUCAGCCAAGCCGGGACCCGCAAGUCAGAAGACCUGCCAUGACACGAGAUGACGU
RS 3 dot .(((.(((.(((((((..((…..)))))))))..)))…)))………(((((((….((((((..(((.(((((……..)))).).)))..))))))….))))..)))((((((((.((………))))))))))….(((.(((….))).)))(((……..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table