Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000291 Similarity: 0.981 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA000291
Gene: ABCB1
MFE: -17.171
ENS: 0.894
Length: 75.
Predicted Ligands:
fluoride - 7/20
guanidine - 5/20
homocysteine - 2/20
 RS: URS0000C429E5_1736407
MFE: -32.865
Ligand: homocysteine
Species: Frateuria sp. Soil773 S-adenosyl-L-homocysteine riboswitch
 RS: URS00021EDD1E_220668
MFE: -37.763
Ligand: guanidine
Species: Lacticaseibacillus plantarum WCFS1 guanidine-IV riboswitch
 RS: URS00021EDBD1_12908
MFE: -21.599
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000291 URS0000C429E5_1736407 URS00021EDD1E_220668 URS00021EDBD1_12908
Length 75. 75. 75. 74.
Similarity - 0.981 0.975 0.975
Ensemble Norm 0.894 - - -
MFE -17.171 -32.865 -37.763 -21.599
Ligands - homocysteine guanidine guanidine
Gene ABCB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.006 31.004 31.005
Length SE - 0. 0. 1.
Lev Distance - 22. 25. 24.
UBS 2. 3. 4. 3.
BS 5. 4. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 1.
BL 3. 4. 2. 1.
BR 1. 4. 2. 1.
UN 0.173 0.093 0.107 0.243

Sequences

Field Description
UTR seq + 25 augcgagcuagacccugcggugaucagcagucacauugcacaucuuucugATGGATCTTGAAGGGGACCGCAATG
UTR dot + 25 .((((..(….((((.(((.((((.(((((…))))).((((…..))))))))))).)))))..))))…
RS 1 seq UCCGUCGAGGGGCGCUGCGACCGUGGAUGCACGGCCAGGCUCGGCGGAACGACCCUGCAACGGCGCUCGAUGGUU
RS 1 dot .((((((((.(.((.((…(((((….))))).((((.(((……))).)))))).)).).))))))))..
RS 2 seq GAUGAAUUGUCACCGGACAACGUUAACCCAACUUCCUUAGGUCAUUGUGGAAGUUGGGUGGACGUUGUCCUUUUU
RS 2 dot (((…..)))…((((((((((.(((((((((((.(((….))).))))))))))).))))))))))…..
RS 3 seq AAAAAAUUACCGCCGGGUAGCGCUUUCUCAACUUCGUUAGGCCUUAGAAGAAGUGAGAAUAGCGUUAUUUUUUU
RS 3 dot …………..(((((((((((((((.(((((…………..)))))))))).))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table