Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000308 Similarity: 0.984 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA000308
Gene: ABCB5
MFE: -11.235
ENS: 0.749
Length: 83.
Predicted Ligands:
cyclic-di-GMP - 8/20
zmp-ztp - 6/20
guanidine - 3/20
 RS: URS0000D689A1_290402
MFE: -11.678
Ligand: cyclic-di-GMP
Species: Clostridium beijerinckii NCIMB 8052 Cyclic di-GMP-II riboswitch
 RS: URS0000D816C4_225345
MFE: -10.096
Ligand: cyclic-di-GMP
Species: Clostridium chromoreductans Cyclic di-GMP-II riboswitch
 RS: URS0000C55735_1660129
MFE: -31.290
Ligand: zmp-ztp
Species: Phenylobacterium sp. SCN 70-31 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000308 URS0000D689A1_290402 URS0000D816C4_225345 URS0000C55735_1660129
Length 83. 83. 83. 84.
Similarity - 0.984 0.984 0.984
Ensemble Norm 0.749 - - -
MFE -11.235 -11.678 -10.096 -31.290
Ligands - cyclic-di-GMP cyclic-di-GMP zmp-ztp
Gene ABCB5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.012 2.015 5.
Length SE - 0. 0. 1.
Lev Distance - 20. 21. 19.
UBS 6. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 2. 2. 0.
H 3. 2. 2. 3.
BL 1. 1. 1. 2.
BR 2. 1. 2. 3.
UN 0.193 0.301 0.313 0.214

Sequences

Field Description
UTR seq + 25 ugucugauuauaggcaacagguuccaggauuggcgucuuaacacaaaaugcaacuaacATGGTGGATGAGAATGACATCAGAG
UTR dot + 25 ((((((….))))))…….(((….)))(((((((.(((…(((…….))).)))..))))).))………
RS 1 seq UGUCAUAAGGAAACUUUGAUCCAUAUAUUUUAAUUGGGCACUUUAUAUAUGGUGAGUUAGUAGUGCAACCGACCUUUAUAUUU
RS 1 dot .((((.(((….)))))))………….((((((((((((..(……)..))).)))))..))))………..
RS 2 seq UAUGUUAUAGGGAACGAUGAUUCAUAUAUUUAUUUGGGCACUUUAUAUGUGAUGAGUUAAUAGUGCAACCGACCUUUAUAGUU
RS 2 dot …(((((.(….).)))))…………((((((((((((..(……)..))).)))))..))))………..
RS 3 seq GCCAUCCCGCGUGACUGGCGAAUGAGGUGGGCGACCACCGGGGAGCGCGGCGACCAUAUCCUGCCGCUCGCCUGGGCAUCUCUC
RS 3 dot ((((((……)).))))……(((((….)))))((.((((((((.((…..)))))).)))).))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table