Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000357 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA000357
Gene: ABCC11
MFE: -9.751
ENS: 0.873
Length: 89.
Predicted Ligands:
TPP - 9/20
glycine - 8/20
GMP - 1/20
 RS: URS0000DAEA1B_159291
MFE: -35.956
Ligand: TPP
Species: Spirochaeta americana TPP riboswitch (THI element)
 RS: URS000080DF55_666
MFE: -32.615
Ligand: glycine
Species: domain II of glycine riboswitch from Vibrio cholerae (PDB 3OXD, chain A)
 RS: URS0000C58A8B_1263006
MFE: -15.558
Ligand: glycine
Species: Firmicutes bacterium CAG:170 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000357 URS0000DAEA1B_159291 URS000080DF55_666 URS0000C58A8B_1263006
Length 89. 90. 88. 89.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.873 - - -
MFE -9.751 -35.956 -32.615 -15.558
Ligands - TPP glycine glycine
Gene ABCC11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.021 2.005
Length SE - 1. 1. 0.
Lev Distance - 27. 27. 29.
UBS 5. 4. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 1. 1. 0.
H 3. 3. 3. 3.
BL 0. 0. 1. 1.
BR 1. 0. 1. 2.
UN 0.225 0.233 0.080 0.292

Sequences

Field Description
UTR seq + 25 guguauuugaauaaaccagguuggcaaaucauacuauagcugaaagaauuggcaggaacugaaaATGACTAGGAAGAGGACATACTGGG
UTR dot + 25 (((((((((……(((…)))))))).))))….(((((…..)))))……………((((…………)))).
RS 1 seq CGGGGGGCUCGCUAUAACGCCGCGAGCUGAGAUGAGAGGGGCAAACCUCUCGACCCGAAGAACCUGAUCCGGGUAAUGCCGGCGUAGGGA
RS 1 dot …..(((((((………)))))))….(((((((……)))))))……….((((..((((……))))..))))..
RS 2 seq GGCUCUGGAGAGAACCGUUUAAUCGGUCGCCGAACGAGCAAGCUCUGCGGAAACGCAGAGUGAAACUCUGAGGCAAAAGGACAGAGUC
RS 2 dot .(((((((.((…(((……))))).)))…))))..((((((((….))))))))…((((((………..)))))).
RS 3 seq GAAGGAAUCUCUGGAGAACUCAUUGAAUUGGGUGCCGAAGGUGCAAGGCGAACGCCGAAUCUCUCAGGCAAAAGGACAGAGUGCAGCAU
RS 3 dot ……((((.(((…(((((……))))).))).))))….(((….)))………..(((………..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table