Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000359 Similarity: 0.970 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA000359
Gene: ABCC11_0
MFE: -30.055
ENS: 0.764
Length: 130.
Predicted Ligands:
FMN - 12/20
cobalamin - 6/20
TPP - 2/20
 RS: URS0000C4A6D8_1195236
MFE: -38.339
Ligand: TPP
Species: [Clostridium] termitidis CT1112 TPP riboswitch (THI element)
 RS: URS0000C5EC94_1660094
MFE: -41.527
Ligand: FMN
Species: Clostridium sp. SCN 57-10 FMN riboswitch (RFN element)
 RS: URS000232A066_525903
MFE: -46.225
Ligand: cobalamin
Species: Thermanaerovibrio acidaminovorans DSM 6589 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000359 URS0000C4A6D8_1195236 URS0000C5EC94_1660094 URS000232A066_525903
Length 130. 129. 130. 130.
Similarity - 0.970 0.968 0.967
Ensemble Norm 0.764 - - -
MFE -30.055 -38.339 -41.527 -46.225
Ligands - TPP FMN cobalamin
Gene ABCC11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 8.004 3.001
Length SE - 1. 0. 0.
Lev Distance - 38. 41. 44.
UBS 7. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 3.
ILR 2. 1. 2. 2.
H 5. 6. 4. 5.
BL 0. 0. 1. 0.
BR 0. 0. 2. 1.
UN 0. 0.163 0.262 0.223

Sequences

Field Description
UTR seq + 25 uuaaaaaggcuccugcaggcaacaugccugcacacuaacgugcagaaagggacuguacuacucaaaaccaccaaggaaguggcagagaauuggcaggaacugaaaATGACTAGGAAGAGGACATACTGGG
UTR dot + 25 ………….((((((((…))))))))…….((((((…….))))))..(((….((((…….))))..))).(((..(((…)))..)))..((((…………)))).
RS 1 seq UACCUGAACGGGGAGCUGAAAAUUGAUUCGGCUGAGAUAAGUAUAUUUACUUAAAACCCUUUGGAAUGCUCUGCAUUCCAUGUACCUGAUCUGGGUAAUGCCAGCGUAGGAAAGCUUAUUGUCAUGCUG
RS 1 dot ..(((…..)))(((((((……)))))))….((((((….))))))……..((((((((…))))))))….((((..((((……))))..))))..(((……….))).
RS 2 seq AGGUUGUUUCAGGGCGGGGUGUGAGUCCCCACCGGCGGUAAUGAGGCGCAUGCCUUUAGUCCGCGAGCGGUAACGCAGAUCGGGUGCGAUCCCCGAACCGACGGUAUAGUCCGGAUGAAAGAAGCAGUGC
RS 2 dot …………((.((((…….)))).)).((((….(((((….)))))….))))…((((..((..(((((….)))))..)).)))).(((……)))……………..
RS 3 seq AGAACCUAUAAUCCACCCGGUAAACAAACUGGGCCCCCUCGGGGCAACUCCGGUGAAAGUCCGGGGCAGCCCCGCUACUGUGAGGACCUUACGUCCAAGCCAGAAAACCCGACGGGGCCGGGAAGGAUGU
RS 3 dot ……………((((((……))))))……((((((..((((((…….))))))..))))))((…((..((((…..))))..)).))….(((….)))((…..))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table