Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000395 Similarity: 0.991 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA000395
Gene: ABCC9
MFE: -8.067
ENS: 0.897
Length: 45.
Predicted Ligands:
preQ_1 - 17/20
SAM - 2/20
glutamine - 1/20
 RS: URS0000D65FCB_12908
MFE: -7.475
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000AB8C73_887898
MFE: -9.546
Ligand: preQ_1
Species: Lautropia mirabilis ATCC 51599 PreQ1 riboswitch
 RS: URS0000AB1925_71421
MFE: -2.490
Ligand: preQ_1
Species: Haemophilus influenzae Rd KW20 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000395 URS0000D65FCB_12908 URS0000AB8C73_887898 URS0000AB1925_71421
Length 45. 46. 45. 45.
Similarity - 0.991 0.990 0.989
Ensemble Norm 0.897 - - -
MFE -8.067 -7.475 -9.546 -2.490
Ligands - glutamine preQ_1 preQ_1
Gene ABCC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.013 3.002 2.
Length SE - 1. 0. 0.
Lev Distance - 9. 13. 14.
UBS 2. 4. 3. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 0. 1. 0.
H 1. 1. 1. 1.
BL 0. 1. 1. 1.
BR 0. 2. 0. 0.
UN 0. 0.087 0.156 0.

Sequences

Field Description
UTR seq + 25 aguaaaccauauaagaagaaATGAGCCTTTCATTTTGTGGTAACA
UTR dot + 25 …..(((((…….(((((((…..))))))))))))….
RS 1 seq AUCGUUCAUCCCAAUGGGACGCAAGUAAGCCGACUCGGAACGGAUU
RS 1 dot .((((((…….((((.(((……)).).))))))))))…
RS 2 seq GCCCCCGUGGUUCGAAAAACGCCCACGUUAAAAAACUAGGGAAGA
RS 2 dot …(((.(((((…..((((….))))….))))))))….
RS 3 seq CCCCCCGUAGUUCGCAAACCUCCUACAAUAAAAAACUAGGUAAAA
RS 3 dot ….((.(((((…………………)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table