Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000404 Similarity: 0.984 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA000404
Gene: ABCD3
MFE: -36.287
ENS: 0.608
Length: 91.
Predicted Ligands:
glycine - 8/20
TPP - 5/20
tetrahydrofolate - 3/20
 RS: URS0000AB258B_747682
MFE: -17.872
Ligand: TPP
Species: Mycoplasma alligatoris A21JP2 TPP riboswitch (THI element)
 RS: URS0000BEB0B2_1328760
MFE: -22.334
Ligand: TPP
Species: Xylona heveae TC161 TPP riboswitch (THI element)
 RS: URS0000C04B85_1121324
MFE: -20.790
Ligand: glycine
Species: Peptoclostridium litorale DSM 5388 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000404 URS0000AB258B_747682 URS0000BEB0B2_1328760 URS0000C04B85_1121324
Length 91. 92. 91. 91.
Similarity - 0.984 0.982 0.981
Ensemble Norm 0.608 - - -
MFE -36.287 -17.872 -22.334 -20.790
Ligands - TPP TPP glycine
Gene ABCD3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 3.002 11.
Length SE - 1. 0. 0.
Lev Distance - 20. 23. 21.
UBS 7. 7. 8. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 2.
ILR 4. 3. 3. 5.
H 1. 1. 1. 1.
BL 2. 2. 3. 0.
BR 2. 2. 2. 0.
UN 0.198 0.152 0.154 0.176

Sequences

Field Description
UTR seq + 25 aguaagguagccgccgccgccgccgccgccgcguccccucgccggcucgcugguaccggcagugccATGGCGGCCTTCAGCAAGTACTTGA
UTR dot + 25 …..((..(((((((.(((.((((..((((((..((……))..))).)))..)))).)))…)))))))..))………….
RS 1 seq AACAUGUAACAAGGGUGCCGUUAAAUUGGCUGAGAAUAUACCUUCAAGCAGAUCGAGAUAAUGCUCGCGUUGCAAGUUAUUUUUUAUAUAUC
RS 1 dot (((.((((((..((((…((((..(((((((.(((……)))…))).))))..))))))))..)))))).)))…………..
RS 2 seq AAUAGACGUGUCGGGGGGCGGUUGUUCUGAGAUUAGACCGUCAAGACUUGAUCUGGAUAAUUCCGGCGCAAGGACAUGCUUCUCUUCCCCU
RS 2 dot …((.((((((..(.(.(((((((((..(((((((..(…..)..)))))))))))))..))).).)…))))))))………..
RS 3 seq GGACACGCCCCUGGAGAGACCCGUAAAGGGCAUCGAAGAAGAAACCCAGCUACUUGGGGAAUCUUUCAGAUAAAAGGACAGGGUAUGAAUC
RS 3 dot ……..(((((((((((((((((..(((..((……))..)))…)))..)))…))))))………..)))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table