Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000498 Similarity: 0.943 Similarity: 0.943 Similarity: 0.942
UTR: 5HSAA000498
Gene: ABCF3_1
MFE: -68.489
ENS: 0.746
Length: 210.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0002322170_1300222
MFE: -68.772
Ligand: cobalamin
Species: Brevibacillus borstelensis AK1 Cobalamin riboswitch
 RS: URS000232E555_472759
MFE: -66.855
Ligand: cobalamin
Species: Nitrosococcus halophilus Nc4 Cobalamin riboswitch
 RS: URS00023231A6_1504536
MFE: -45.740
Ligand: cobalamin
Species: Robinsoniella sp. RHS Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000498 URS0002322170_1300222 URS000232E555_472759 URS00023231A6_1504536
Length 210. 210. 209. 208.
Similarity - 0.943 0.943 0.942
Ensemble Norm 0.746 - - -
MFE -68.489 -68.772 -66.855 -45.740
Ligands - cobalamin cobalamin cobalamin
Gene ABCF3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 6. 3.
Length SE - 0. 1. 4.
Lev Distance - 74. 72. 70.
UBS 15. 14. 15. 14.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 2. 3. 3. 2.
H 7. 6. 7. 7.
BL 5. 4. 3. 4.
BR 3. 3. 4. 3.
UN 0. 0.124 0.115 0.115

Sequences

Field Description
UTR seq + 25 gacggguuccugaguggaacauggcgacuugcgccgaaauccugcggagcgaguuccccgaaauugacggacaagucuucgacuacgugugccagcgcauguacaacacucugcgucuggcugagccacaaagccagggaaauagccaggugcuacuggacgccccuauccaguugucaaagauaATGGCGACTTGCGCCGAAATCCTGC
UTR dot + 25 …..(((((…..)))))..((.(((((((.(((……..))).))))))).))((((…(((……)))))))..((((((((….))))))))…(((.(((.((((((((………))))))…….))))))))(.((((((……..)))))).)…..(((..(((((…..)))))..)))….
RS 1 seq UGAAUACAUACGCUUUAUGGUGUGAACCGGGUAGUCUCUUGUACCCGGCCACUUAAAAGGGAAGUUCGGUGAAAAUCCGACGCGGUCCCGCCACUGUAAAGGGGAGUGUCCUUGCUGGUAUCCACUGUUUCGCGGUCUAAACGCGAGAUGGGAAGGGAGCAAGGCGUGAUGAUCCCAAGCCAGGAGACCUGCCAGAAAGCAUACACGAUC
RS 1 dot ……..((((((….))))))..(((((((……..)))))))……….((((.((((((…….)))).))..))))..((((.(…..).)))).(((((((….(((.((((((((((…….))))))))))…))))))))))(((((((…….(.((((…)))))…….))).))))…
RS 2 seq AUUGCCCAGCUCACUACAGGUGCCCCGAUCCUGACCAGGGGUUAAACGGGAAGUCGGUCAAAAGCCGACGCUGCCCCCGCAACGGUAGGCAAGAUAGAGACUGGUUACUAAGCCACUGCGGAUUUUCGCGGGAAGGCGAUCAGUACUGGCGGAUAUUGUGAUUUCCGCCACUUGCGAGCCCGGAGACCGGCCUAGAGUGCCAUGCGAUG
RS 2 dot …((((………..)).))(((((((((…..)))))….))))..((((((…..))))))..((((.(((…)))..))))……(((((((((…..(((.((((((….))))))…)))))))))).)).(((((……….)))))(((((…((.((((…)))).)).)))))……….
RS 3 seq UUUAAUAUUGCUAUAUUAAGUGCUAAGGUUAAUAUCAGGACGAAGGGUAUUAAUUUUAGAAGAGGGAAUUAGGUGAGAAUCCUAAGCGAUCCGGUCACUGUAUUCAGGGAGUGAACCUUCAUAAUCCAUUGCAUAACCCAUUGUGUGAGAAGGAGAAGGCAAACUAUGAUCUGUAAGUCAGGAAACCUGCUUAAUGUAUGAGAUGCGC
RS 3 dot ((((((((….))))))))..((((((((((((((………))))))))))))))..((..(..(((((…….))))).)..))((.((.(((….))).)).))..(((((….(((.((((((((….))))))))…))))))))…………..((((.((((…))))))))..((((…))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table