Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA000926 Similarity: 0.968 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA000926
Gene: ACAD8
MFE: -56.
ENS: 0.816
Length: 131.
Predicted Ligands:
FMN - 7/20
molybdenum - 4/20
SAM - 3/20
 RS: URS0000C465FE_1869167
MFE: -53.258
Ligand: FMN
Species: Humibacillus sp. DSM 29435 FMN riboswitch (RFN element)
 RS: URS0000D9959F_1664069
MFE: -30.873
Ligand: SAM
Species: Bacillus glycinifermentans SAM riboswitch (S box leader)
 RS: URS0002322623_1220578
MFE: -36.262
Ligand: cobalamin
Species: Flavihumibacter petaseus NBRC 106054 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA000926 URS0000C465FE_1869167 URS0000D9959F_1664069 URS0002322623_1220578
Length 131. 131. 132. 131.
Similarity - 0.968 0.964 0.964
Ensemble Norm 0.816 - - -
MFE -56. -53.258 -30.873 -36.262
Ligands - FMN SAM cobalamin
Gene ACAD8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9. 2.001
Length SE - 0. 1. 0.
Lev Distance - 42. 43. 48.
UBS 10. 10. 9. 9.
BS 0. 0. 1. 0.
ILL 3. 2. 3. 3.
ILR 3. 2. 4. 3.
H 4. 4. 3. 4.
BL 3. 3. 1. 2.
BR 1. 2. 2. 1.
UN 0.069 0.076 0.083 0.107

Sequences

Field Description
UTR seq + 25 agggugcagugggacaggcguugccgggucgcaggucccgccagugcgagcgcaacggaggucgaaggcguucagacucuuagcugaacgcggagcugcggcggcuATGCTGTGGAGCGGCTGCCGGCGTT
UTR dot + 25 …((((.(((((((..(((………)))..)))))))..))))((.(……..).))….((((((((.((…))))))))))..(((..((((((((..(((….)))))))))))..)))
RS 1 seq UCACGUGCUCCGGGGUCGGUGUAAUUCCGAGCCGGCGGUUACAGUCCGCGACCCGGCCGCAGCCAGCGGCCGGUUGACCUGGUGAAACUCCAGGACCGACGGUGAAAGUCCGGAUGGGAGGCAGCACGAGG
RS 1 dot …((.(((.((((((…….)))))))))))((((…….))))…((((((((…..))))))))….(((.(((…((((….(((((…….))).))…))))….))).)))
RS 2 seq CUCUUAUCCCGAGCUGGCGGAGGGACAGGCCCAAUGAAGCCCAGCAACCGGUUUCUCUUCAUCAUCACAGUUUUCGAGACAACUACGGUGCUAACCUGAUGCAAGGUUUUGACAUACCUUGAGCGAUAAGAG
RS 2 dot (((((((((((.(((((((..(((…..)))..))….)))))…)))……..(((((….(((..(((((….)).))).)))….)))))((((((……..))))))…))))))))
RS 3 seq UCUUAAAUAAUAUGUGAAGGUGCAAUACUUCCGGUAUUGCUUAAAAGGGAACCACGUGUAAUUCGUGGGCUGACGGGCAACUGUGAUCCGCCUAGCGGAAGCCAGAUACCUGCCGAAACAUAUUUGUUUGG
RS 3 dot ..((((.((((((..((((……..))))..)))))).))))…….(((((…….)))))…..((((…(((…(((((…)))))…)))…))))((.(((((….)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table