Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001023 Similarity: 0.967 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA001023
Gene: ACAP3
MFE: -45.239
ENS: 0.732
Length: 128.
Predicted Ligands:
glycine - 5/20
TPP - 4/20
SAM - 4/20
 RS: URS0000AB2B58_479435
MFE: -52.844
Ligand: TPP
Species: Kribbella flavida DSM 17836 TPP riboswitch (THI element)
 RS: URS00003CC219_1003195
MFE: -54.004
Ligand: glycine
Species: Streptomyces cattleya NRRL 8057 = DSM 46488 Glycine
 RS: URS0000C56215_1523413
MFE: -45.053
Ligand: glycine
Species: Novosphingobium sp. AAP1 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001023 URS0000AB2B58_479435 URS00003CC219_1003195 URS0000C56215_1523413
Length 128. 128. 128. 126.
Similarity - 0.967 0.965 0.965
Ensemble Norm 0.732 - - -
MFE -45.239 -52.844 -54.004 -45.053
Ligands - TPP glycine glycine
Gene ACAP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 10.001 6.
Length SE - 0. 0. 4.
Lev Distance - 43. 42. 39.
UBS 11. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 1.
ILR 2. 1. 2. 3.
H 3. 3. 3. 3.
BL 6. 6. 4. 4.
BR 4. 3. 5. 4.
UN 0.047 0.047 0.016 0.040

Sequences

Field Description
UTR seq + 25 gccaugaccguggaguucgaggagugcgucaaggacuccccgcgcuucagacgugugcacaagugugcaucggcuuugcuugguggacauuuggcaaacgacaATGACCGTGGAGTTCGAGGAGTGCG
UTR dot + 25 .((((….))))…..(.(((((.(…..).))))))((((((((.(((((.(((.(((((((.(((((((…))).)))).)))))))))).)))…………….))..))))))))
RS 1 seq ACACACCUCUGCGGGAGCUCGCACCGAACUGCGGGCUGAGAGGGCGACGAGCUGUUACCCGGCCGGGUCGCCGACCGCCUGAACCUGACCGGGUAAUGCCGGCGUAGGGAGCCAGGUCCGAUGGCCUU
RS 1 dot …..(((((.(…((((((((……))))))))))))))(((.((.((.(((((((((.((((((((…..))..)).)))).))))))))))))).))).(((.((((…….)))))))
RS 2 seq UCACUCUGGAAAGCAGGCAGGUGCCGGCGGCGCGCGACACGGCCGGGGCCCCUCCUCACCGACGGGGAAAGCCGUGACCGCGUACCGCGGAGCGGUGAAACUCUCAGGUUCAUGACAGAGGGGGAGGC
RS 2 dot .(((.(((………))))))(((((.(.(…..).).))))).(((((((((((((((.(((….(((((..(((((…))))).)))))….))))).)))……..))))))).)))
RS 3 seq UAGCGACACUCUGGAAAGUGUUUCAUUUCCUUGCGGAAAUGGGGCCGCCGAAGGGGUAACCCCGCGAUGCGCCACAACUAGGGGCGCGGGGGAAAGCUCUCAGGUUUCCGUGACAGAGGGGGCACC
RS 3 dot ….((((((……)))))).(((((((….)))))))(((((.((((((((((…(((.((.(((.((…….)).))))).)))…)))))…..)))………)).))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table