Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001113 Similarity: 0.989 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA001113
Gene: ACE
MFE: -16.232
ENS: 0.677
Length: 47.
Predicted Ligands:
SAM - 9/20
glutamine - 6/20
unknown - 4/20
 RS: URS00021EDEC8_12908
MFE: -7.899
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000AB2AFF_408172
MFE: -10.099
Ligand: SAM
Species: marine metagenome SAM/SAH riboswitch
 RS: URS0000D67410_12908
MFE: -24.
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001113 URS00021EDEC8_12908 URS0000AB2AFF_408172 URS0000D67410_12908
Length 47. 47. 48. 47.
Similarity - 0.989 0.988 0.987
Ensemble Norm 0.677 - - -
MFE -16.232 -7.899 -10.099 -24.
Ligands - SAM SAM unknown
Gene ACE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.016 10.010 3.029
Length SE - 0. 1. 0.
Lev Distance - 12. 12. 16.
UBS 5. 3. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 2. 2. 1.
H 1. 1. 1. 1.
BL 3. 1. 1. 2.
BR 1. 0. 0. 1.
UN 0.170 0.298 0.271 0.

Sequences

Field Description
UTR seq + 25 gccgagcaccgcgcaccgcgucATGGGCCAGGGTTGGGCTACTGCAG
UTR dot + 25 (((.(((.((..((.(((…..)))))..))))).)))……..
RS 1 seq UUCUACUACAACGGCUUCCUGGCGUAGUUUGAAAUGUAAUUGGAGCG
RS 1 dot (((.(((((..(((….)))..)))))..)))…………..
RS 2 seq UGAUGCACGCAACGGCUUCCUGACGCGUGAGAUUAAAUUAUUGGAGCA
RS 2 dot ((((.(((((..(((….)))..)))))..))))………….
RS 3 seq GGGUGCGGCGCCGGGCCGCAGGAGAGCGGAUGGUCGGGCCGCCAUCC
RS 3 dot (((((((((.((((.((((……))))….)))))))).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table