Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001281 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA001281
Gene: ACP2
MFE: -58.553
ENS: 0.792
Length: 142.
Predicted Ligands:
molybdenum - 5/20
cobalamin - 5/20
SAM - 3/20
 RS: URS0000C5FA23_2342
MFE: -47.670
Ligand: molybdenum
Species: primary endosymbiont of Sitophilus oryzae Moco (molybdenum cofactor) riboswitch
 RS: URS0000C3231D_1402860
MFE: -37.650
Ligand: SAM
Species: Bacillus enclensis SAM riboswitch (S box leader)
 RS: URS0000ABC168_717231
MFE: -39.704
Ligand: molybdenum
Species: Flexistipes sinusarabici DSM 4947 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001281 URS0000C5FA23_2342 URS0000C3231D_1402860 URS0000ABC168_717231
Length 142. 142. 141. 141.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.792 - - -
MFE -58.553 -47.670 -37.650 -39.704
Ligands - molybdenum SAM molybdenum
Gene ACP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 20. 11.001
Length SE - 0. 1. 1.
Lev Distance - 48. 41. 46.
UBS 10. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 3.
ILR 0. 2. 4. 3.
H 3. 4. 3. 3.
BL 3. 2. 2. 2.
BR 4. 4. 3. 3.
UN 0.099 0.077 0.121 0.071

Sequences

Field Description
UTR seq + 25 aaguaagauggcggcgaacgcacuuccggcguguguccuuacgggugcguccgggcggcugcuugcaggugccacccagcggguuccagcuuguuugcugcauagauuacaacggugATGGCGGGCAAGCGGTCCGGCTGGA
UTR dot + 25 ………..(((…(((((((…..((((……))))))))))))))((((.(((….))).))))..(((((.((..((.(((((((((((((((………..))).)))))))))))))).)).))))).
RS 1 seq AAGGUAACAUAACUCCUAGCCUUUACGCCUAAGUGGCUCCCGAUGAGCCAUACGGGGUUCUGGCCGUGGCGAUGGCCACCAGGGUGCAGGGUAGAAAUGCCGGCAUCUUCCGUAUUUGGAAAGGUGUUACUGUGUCACAACU
RS 1 dot .(((……….))).(((…((.((…(((((((…..)))))))..)).))…))).(((((….)))))….(((((.((((………((((((((((….))))).))))))))).)).)))….
RS 2 seq CUCUUAUCCUGAGCUGGUGGAGGGAGCAGACCCUAUGAAACCCAGCAACCUGCUAAAUAGAUAGUGGGUCUUUCUUAUUGAAGGAUCCCAUGAAGCGAAGGUGCUAAACUGAGGCAAGGUGGAUACCUUGAACGAUAAGAG
RS 2 dot …………((((((.(((((……)))).).)…))))).((((((((……))))))))…((((((((((((((.((((…((…(((…..)))…))…)))))).))))…)))))))).
RS 3 seq AAAAAAAAUCAUCUCCGAGUUUAUAAGUCUAAGUCGGUAAAAUACGAUAUGACUUAUAAACCGGUUGGGUUCAGCCCCCAGGGUUUGGACGGAAACGCCCAUGCCUCCCGAAAUUUGGAAAGGAGAUAACUGGUAGUUUUA
RS 3 dot ……..(((…(((.(((((((((((…((((……..))))..)))))))))))))).)))(((((((((…))))).)))).(((((..(((((.((((………….)))).))..)))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table