Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001650 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA001650
Gene: ACSS2
MFE: -44.744
ENS: 0.937
Length: 99.
Predicted Ligands:
tetrahydrofolate - 14/20
glycine - 4/20
purine - 1/20
 RS: URS0000C1B597_1262822
MFE: -18.484
Ligand: tetrahydrofolate
Species: Clostridium sp. CAG:571 THF riboswitch
 RS: URS0000DA6EAC_1121345
MFE: -29.450
Ligand: tetrahydrofolate
Species: Anaerocolumna xylanovorans DSM 12503 THF riboswitch
 RS: URS0000C29C09_1262810
MFE: -17.484
Ligand: tetrahydrofolate
Species: Clostridium sp. CAG:452 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001650 URS0000C1B597_1262822 URS0000DA6EAC_1121345 URS0000C29C09_1262810
Length 99. 100. 99. 100.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.937 - - -
MFE -44.744 -18.484 -29.450 -17.484
Ligands - tetrahydrofolate tetrahydrofolate tetrahydrofolate
Gene ACSS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 5.004 2.002
Length SE - 1. 0. 1.
Lev Distance - 21. 23. 23.
UBS 7. 6. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 0.
ILR 3. 2. 3. 2.
H 1. 1. 1. 1.
BL 3. 3. 3. 3.
BR 2. 2. 2. 3.
UN 0.061 0.110 0. 0.110

Sequences

Field Description
UTR seq + 25 aguucggccuguuuucucagucccggcacccgccgcgaccgcaaaggcggccgcgguucuaggaacuugacgugATGGGGCTTCCTGAGGAGCGGGTCC
UTR dot + 25 …..((((((.(((((((((((((.(((((((((((.((((….)))).))))))….))……..))).)))))))….)))))))))))).
RS 1 seq AUUAGAGUAGAAAAUAAAUAGUAAAGACCUAAUAAACGGGAAGUUGUUAUUAGGGCAAAUAAAAUAAUUUUAUGCUUAUUUAUUUUCGCAUUCCGCUAAU
RS 1 dot ….((((.((((((((((((((.(((((((((.(((((….)))))))))))…………..))).)))).))))))))))..))))…….
RS 2 seq AGCAGAGUAGGAUUUCGUGCGUUAAGUGUCACCGGAACGGGGAGUUGUCCGGUGAACGAAAAGGUAAAACUUGCGGUACGAUUUUCGCAUCCCGCUGCU
RS 2 dot (((((.(..((((.((((((..(((((((((((((.((((….))))))))))).)………..)))))..))))))…….))))).)))))
RS 3 seq AAUAGAGUAGAGAAUAAAUAGUUAAGUGUUACUAAACGGGAAGUUGUUAGUAAACGAAAAAGCUUUUAGCUUUGCUGAUUUAUUUUCGCAUUCCGCUAUU
RS 3 dot ….((((.(((((((((((((.((((((((((.(((((….)))))))))).)………….)))).)))).)))))))))..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table