Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001795 Similarity: 0.990 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA001795
Gene: ACTR5
MFE: -15.892
ENS: 0.929
Length: 58.
Predicted Ligands:
unknown - 13/20
fluoride - 7/20

 RS: URS0000BFCA74_650150
MFE: -12.581
Ligand: fluoride
Species: Erysipelothrix rhusiopathiae str. Fujisawa Fluoride riboswitch
 RS: URS0000D67764_322710
MFE: -25.021
Ligand: unknown
Species: Azotobacter vinelandii DJ nhaA-I
 RS: URS0000D6830C_169430
MFE: -22.342
Ligand: unknown
Species: Paraburkholderia hospita nhaA-I
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001795 URS0000BFCA74_650150 URS0000D67764_322710 URS0000D6830C_169430
Length 58. 58. 58. 57.
Similarity - 0.990 0.989 0.988
Ensemble Norm 0.929 - - -
MFE -15.892 -12.581 -25.021 -22.342
Ligands - fluoride unknown unknown
Gene ACTR5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 3.036 2.024
Length SE - 0. 0. 1.
Lev Distance - 13. 14. 15.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 1. 0. 1. 1.
H 1. 1. 2. 1.
BL 1. 2. 1. 1.
BR 2. 2. 2. 1.
UN 0.224 0.241 0.034 0.070

Sequences

Field Description
UTR seq + 25 agagguuaagaaacguagaauuucgcagccagaATGGCGGCGAACGTGTTCCCGTTCC
UTR dot + 25 ………..((((..(((((((((.((((…)))).)))))…)))).))))..
RS 1 seq UUACAAAACGGUGAUGGGGUUUGUCAUAACUGCGACAGCUGAUAACUCCUACAUAAGA
RS 1 dot ……….(((.(((((.((((((…(((…))).)))))).))))))))….
RS 2 seq GGGUGUCGGGUCCGCGGGUGCGGCCGGACAGGUUUCUUGUGUCGGUCGGGCCGCCGCA
RS 2 dot .((……..))((((((.((((((((((((…))))).))))))).)))..))).
RS 3 seq GGGUGUUAGCUGCAUGCCACAGCGGCGCAGGUCAACUGUGCUGGUCGGGCCGCCACG
RS 3 dot .((((……….(((..(.((((((((…..)))))))).)..)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table