Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001798 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA001798
Gene: ACTR6
MFE: -24.432
ENS: 0.992
Length: 81.
Predicted Ligands:
zmp-ztp - 10/20
SAM - 6/20
homocysteine - 3/20
 RS: URS000231991B_243233
MFE: -39.332
Ligand: homocysteine
Species: Methylococcus capsulatus str. Bath S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C5DC97_366602
MFE: -33.132
Ligand: zmp-ztp
Species: Caulobacter sp. K31 ZMP/ZTP riboswitch
 RS: URS0000C736A9_1423744
MFE: -16.866
Ligand: SAM
Species: Lactobacillus floricola DSM 23037 = JCM 16512 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001798 URS000231991B_243233 URS0000C5DC97_366602 URS0000C736A9_1423744
Length 81. 82. 80. 81.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.992 - - -
MFE -24.432 -39.332 -33.132 -16.866
Ligands - homocysteine zmp-ztp SAM
Gene ACTR6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 7.001 8.001
Length SE - 1. 1. 0.
Lev Distance - 22. 21. 22.
UBS 4. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 2. 2. 3. 4.
H 1. 1. 1. 1.
BL 1. 2. 2. 0.
BR 1. 1. 2. 0.
UN 0.111 0.110 0.087 0.136

Sequences

Field Description
UTR seq + 25 gagcagaggggucggaaagggaaaacaacuacggcugcggugugguugguggugagATGACGACCTTAGTGCTGGATAATG
UTR dot + 25 .((((..(((((((………..((((((((.(…).))))))))…………)))))))..))))……..
RS 1 seq GCGCCGAGGAGCGCUGCGACGGCCCGUCGAGGGCCGCCAGGCUCGGCGGGGACAAUCGGUUUUCCAACGGCGCUCUGUUUAU
RS 1 dot ((((((.((((.((((……((((((((..(((….)))))))))))……)))).))))..))))))………
RS 2 seq GCCCGUUCGCGUGACUGGCGCUAGUGAUGGGGAACCAUCGGGGAGCGCGAACCACAUCGCCGCGCGCCUGGGCUCCUCGA
RS 2 dot (((((..((((((.((.(((((..((((((….))))))…))))).)……..).))))))..)))))…….
RS 3 seq GAUUCUUACUUGUGUUCCCGAUAGGAUCUAGUUAAAUACUAGAUAUGCCUUGUAACCGAAUCGAAGGGGGAAAUAAAAAUG
RS 3 dot ..((((..(((..((((…((((((((((((…..)))))))….)))))….))))..)))..))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table