Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA001883 Similarity: 0.954 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA001883
Gene: ADAD1
MFE: -65.247
ENS: 0.899
Length: 176.
Predicted Ligands:
cobalamin - 10/20
lysine - 3/20
Mg2+ - 2/20
 RS: URS000232F79A_1509431
MFE: -38.151
Ligand: cobalamin
Species: Candidatus Magnetomorum sp. HK-1 Cobalamin riboswitch
 RS: URS0000DA08D5_1121950
MFE: -43.501
Ligand: Mg2+
Species: Hespellia stercorisuis DSM 15480 M-box riboswitch (ykoK leader)
 RS: URS000231350E_1288971
MFE: -40.440
Ligand: cobalamin
Species: [Clostridium] ultunense Esp Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA001883 URS000232F79A_1509431 URS0000DA08D5_1121950 URS000231350E_1288971
Length 176. 177. 175. 177.
Similarity - 0.954 0.951 0.950
Ensemble Norm 0.899 - - -
MFE -65.247 -38.151 -43.501 -40.440
Ligands - cobalamin Mg2+ cobalamin
Gene ADAD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.007 15.001 11.008
Length SE - 1. 1. 1.
Lev Distance - 56. 57. 61.
UBS 11. 11. 14. 12.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 0. 2. 2. 3.
H 5. 4. 6. 4.
BL 3. 4. 3. 3.
BR 4. 2. 3. 4.
UN 0.074 0.158 0.051 0.164

Sequences

Field Description
UTR seq + 25 acgguuagugauuggacgaagcagggcgcgggggcgcaagcccggguccugcaggggcgacgcgaggccucuuuugaaagaugcggcccugacccugugaaccucgcgcagagcggccugaagcgagagguugaggcugggaggugagaaaATGCTGAAAAAGAACCTGCCAGTTC
UTR dot + 25 …(((……..)))…(((((((.((((……..)))).))))))).(((((..((((…..((((….)))))))))))))…(((…((((((.(((………….))).)))))).)))((((.((((……………….)))).))))…
RS 1 seq AUAAAAUUAAAUAUUUUCGAUCCAGGGAAAACGGUGAAAAUCCGUUGCAGAAGACUGCUGCUGUAACCGGAGACAAAUGCUUCAUUCAUGCCACUGUGCAAUUUAAAUAUGCAUGGGAAGGCGGAGUUGUUUGGAUGACCCGGGAGCCAGAAAACCUGACGAAAAAUCCAAAUAUUU
RS 1 dot …………(((((((..((.(……))))))))))(((((((((.((….)).))))))).))………….((((.((((.(((((((………)))))))…))))))))(((((((((….((((……….))))…….)))))))))…
RS 2 seq UAAAAACUUCGGUAGGUGAGGUUACCAUAGGGAUUAGGAUUCAUUUCCUGAGAUUGCUGCCGCGAAAAAAGUGGAGACACUUUCGAGUUGGUUAGCAGGCGUUGUCGAGAUAAGGCACCACCUAAUGCAAUUUUAUAUGCCCUAUGAUACUAAAGCUCAAACGAUGGAAUCAUAG
RS 2 dot ….(((((((…..))))))).((….)).((((((……))))))…(((((((((((…(((((….))))))))…)))).))))((((.(((.(((((…(((……..))).))))))))))))(((((((.(((..(……)..))).)))))))
RS 3 seq UGAAUAUAAAAAAUAUUGGGUUCCUUUUGGAUUAAUAGGGAAACUGGUGUAAAUCCAGUACAGCCCCCGCUACUGUAAUUGGGACGAAAUCAACUUAUACCACUGAGAAUAUCUCGGGAAGGUGUUGAGAGUAGGAUGAUCAUAAGUCAGGAGACCUGCCUGAUGUUUUUGCUAACU
RS 3 dot …………(((((((..(((((.(……).)))))..)))))))…((((((((((………))))).)))))……….((((((((.((((((…))))))…))))).)))(((((((..((((…(.((((…))))).))))..)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table