Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002206 Similarity: 0.969 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA002206
Gene: ADARB1
MFE: -21.125
ENS: 0.948
Length: 132.
Predicted Ligands:
FMN - 13/20
glucosamine - 2/20
cobalamin - 2/20
 RS: URS0000C40C04_1619089
MFE: -27.565
Ligand: glucosamine
Species: candidate division WS6 bacterium GW2011_GWC1_33_20 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0002331F4D_226910
MFE: -32.725
Ligand: cobalamin
Species: Pseudomonas batumici Cobalamin riboswitch
 RS: URS0000C07131_1777880
MFE: -37.244
Ligand: FMN
Species: Streptococcus sp. DD12 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002206 URS0000C40C04_1619089 URS0002331F4D_226910 URS0000C07131_1777880
Length 132. 132. 131. 131.
Similarity - 0.969 0.966 0.966
Ensemble Norm 0.948 - - -
MFE -21.125 -27.565 -32.725 -37.244
Ligands - glucosamine cobalamin FMN
Gene ADARB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 8.024 20.003
Length SE - 0. 1. 1.
Lev Distance - 41. 41. 37.
UBS 8. 9. 7. 11.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 2.
ILR 0. 1. 1. 1.
H 5. 4. 3. 4.
BL 2. 3. 1. 3.
BR 3. 3. 3. 5.
UN 0.273 0.197 0.427 0.214

Sequences

Field Description
UTR seq + 25 aggugaacaccacaacgacugaauagaauaguucccuaggcacagauguuaaagaugccaaggugauaaguguuucuacaggaacaaaauguauuaauggugaauacATGGATATAGAAGATGAAGAAAACA
UTR dot + 25 .(((….)))………((((……))))(((.(((((……….).)))).)))…….((((((….))))))…((((((.(((…….))).))))))…………….
RS 1 seq UAAUUAACUGAAGCGGCUGGGUCUAUAUAGACUACGAGGCGAAGGAUAUCGAAUAAUCAGCGGAUACCUUCAGGUUGUUGUAACAACCUAAAUGAGUUCUACAAAUAUACAAAAAGAAUCUCAAUUUACAUU
RS 1 dot …………..(.((.(((((….))))..).)).)(((((.((((…………)))))))))(((((((….)))))))…((((((((…………..)))).))))………
RS 2 seq AUCAUUUUGUUACUAGAAAAUUUUACAACUCGUUCCGAAACAGGAAGCCGGUUGAAAUCCGGCGCGGUCGCGCCACUGUAUUCGGCUGUUUGUCAGCCGUAAGCCAGACCCUGUUUCUCCAACUCGCAAUC
RS 2 dot …………………….(((((.(((((……)))).).)))))……(((((….))))).(((..((((((((…..)))))).))..)))……………………
RS 3 seq AGGGGUCUUCAGGGCAGGGUGUAAUUCCCUACCGGCGGUGACUAGGUUGUCUUCCUAGAAGUCCGCGAGCGCAAGCUGAUGUGGUGCAAAUCCACAACCGACAGUGAUAGUCUGGAUGGGAGGAGACGAAG
RS 3 dot …………((.((((…….)))).)).(((((..(((((…….)))))..).))))..((((..((….)).))))…(((.((.(((((…….))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table