Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002307 Similarity: 0.968 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA002307
Gene: ADD1
MFE: -44.458
ENS: 0.782
Length: 135.
Predicted Ligands:
cobalamin - 7/20
FMN - 7/20
homocysteine - 3/20
 RS: URS0000C76D8C_1074049
MFE: -43.834
Ligand: homocysteine
Species: Candidatus Burkholderia crenata S-adenosyl-L-homocysteine riboswitch
 RS: URS0002329910_1519493
MFE: -55.970
Ligand: cobalamin
Species: Streptomyces sp. NRRL B-3648 Cobalamin riboswitch
 RS: URS00023165BD_1348663
MFE: -57.545
Ligand: cobalamin
Species: Kitasatospora cheerisanensis KCTC 2395 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002307 URS0000C76D8C_1074049 URS0002329910_1519493 URS00023165BD_1348663
Length 135. 134. 135. 136.
Similarity - 0.968 0.966 0.966
Ensemble Norm 0.782 - - -
MFE -44.458 -43.834 -55.970 -57.545
Ligands - homocysteine cobalamin cobalamin
Gene ADD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.007 8.004 7.001
Length SE - 1. 0. 1.
Lev Distance - 36. 41. 41.
UBS 12. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 3. 1. 4. 4.
H 2. 2. 2. 2.
BL 3. 5. 4. 4.
BR 6. 5. 5. 4.
UN 0.007 0.090 0.074 0.037

Sequences

Field Description
UTR seq + 25 cggagccggagccgacgggcgguggccgcacugggaccccggaaucccgcgcgcugcccacgauucgcuucugaggagaaacauucucaggaaccuagaaagauuguacaATGAATGGTGATTCTCGTGCTGCGG
UTR dot + 25 .((..((((.(((..(((((((…)))).))))).).))))..))((((((((….(((.(((((.(((((((((……))))))))).)………………)))).)))……)))).))))
RS 1 seq CGCUUCGAGGAGCGUUGCGACAGCUUUCAACUUGAUGGCCGCCAGGCUCGAAGCAUUCAAUCGGACGGAGUGACCAGCGCUUUCAGACCAGUAAGCGCUUGUUGAACCACCGCAUCGAACGGCGCUCACGUCAA
RS 1 dot .(((((…((((.(.(((…(((.(((…))).)))))).).)))))))))………(((((((((.(((((((((.(……).)))))))…………………))))))).))))..
RS 2 seq UGUUUGUUAGGCUCCACUCGCCUCCCGUGGGGGAAGUCCGGUGGGAGUCCGGCGCUGACCCGCAACGGUGUGCACGGCGACCGAUCCGAAGGUCUCUGUGCGAGCCCGAUCACCCGCGGAGGCGUAGCGACCCGC
RS 2 dot ………(((((((((.((.((((….)))).))..))))).))))((((((((.(((((…(((((((((((.((((……..)))).)))))))……..)))).)))).)…)))))..))).
RS 3 seq GCAUCUCUCGGGGUGUCCGCUGCCAGCGACGGCACAGCGGAGGAAGUCCGGUGAGAAUCCGGUGCGGUCCCGCCACUGUGACCGCGGCUCAGUGAGCCGUGGGAGCCAGGAACUCCGGCCGUCCUCCACUGCCCGG
RS 3 dot …(((((((((.(.(((((((…((….)).))))))).)…))))).))))..((((.(((((…(((.((((..(((((((((…)))))))))..)).))…….)))……..)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table