Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002475 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA002475
Gene: ADH7
MFE: -13.842
ENS: 0.838
Length: 55.
Predicted Ligands:
unknown - 15/20
glutamine - 2/20
FMN - 2/20
 RS: URS0000D6993C_12908
MFE: -25.158
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0001A16A77_1683
MFE: -18.075
Ligand: unknown
Species: RNA (55-MER) from Bifidobacterium angulatum (PDB 6LAS, chain B)
 RS: URS0000E6012C_1736382
MFE: -27.124
Ligand: unknown
Species: Methylobacterium sp. Leaf456 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002475 URS0000D6993C_12908 URS0001A16A77_1683 URS0000E6012C_1736382
Length 55. 55. 55. 55.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.838 - - -
MFE -13.842 -25.158 -18.075 -27.124
Ligands - unknown unknown unknown
Gene ADH7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.056 2.048 2.048
Length SE - 0. 0. 0.
Lev Distance - 17. 18. 18.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 1. 0. 0.
H 2. 2. 2. 3.
BL 0. 1. 0. 0.
BR 0. 0. 0. 0.
UN 0.364 0.127 0.145 0.145

Sequences

Field Description
UTR seq + 25 aauuaaacacuuggagauauuccuugaggaATGAAATGCTTGGTGAGCAGGCATA
UTR dot + 25 ……………..((((((….))))))..(((((((…..))))))).
RS 1 seq GGGUGCACGGUCCUGCCAGGAUCGGCAGGUCUUCGCGCUGGUCGGGCCGCCAGCG
RS 1 dot …….(((.((((((……))))))…)))(((((((……)))))))
RS 2 seq GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUC
RS 2 dot ……..(((((((……….)))))))(((..(((((…..))))))))
RS 3 seq GGGUGCACGGUCCGGGUUGGACCGGCAGGGAACUGCGCUGGUCGGGCCGCCAGCG
RS 3 dot …….((((((…..))))))((((….))))((((((……)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table