Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002484 Similarity: 0.972 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA002484
Gene: ADI1
MFE: -36.181
ENS: 0.922
Length: 117.
Predicted Ligands:
FMN - 8/20
TPP - 5/20
SAM - 3/20
 RS: URS0000D94388_1764959
MFE: -30.776
Ligand: FMN
Species: Epulopiscium sp. AS2M-Bin002 FMN riboswitch (RFN element)
 RS: URS0000ABBB2D_997350
MFE: -28.195
Ligand: FMN
Species: Peptoniphilus indolicus ATCC 29427 FMN riboswitch (RFN element)
 RS: URS0000DAA9F7_1817845
MFE: -31.325
Ligand: FMN
Species: Candidatus Doudnabacteria bacterium RIFCSPLOWO2_02_FULL_48_13 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002484 URS0000D94388_1764959 URS0000ABBB2D_997350 URS0000DAA9F7_1817845
Length 117. 117. 116. 117.
Similarity - 0.972 0.972 0.971
Ensemble Norm 0.922 - - -
MFE -36.181 -30.776 -28.195 -31.325
Ligands - FMN FMN FMN
Gene ADI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9.006 9.
Length SE - 0. 1. 0.
Lev Distance - 36. 32. 35.
UBS 10. 10. 12. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 1. 2. 1. 0.
H 3. 3. 3. 4.
BL 4. 4. 6. 3.
BR 6. 5. 7. 4.
UN 0.188 0.205 0.112 0.197

Sequences

Field Description
UTR seq + 25 augcgcguccacgccucccuauaagacaaagcgcggccgacgggcuccgagcgcggccccuggguucgaacacggcacccgcacugcgcgucATGTCCGTGAAATCTTCAAAACTTA
UTR dot + 25 ..((.((((…(((.(.((………)).).))).)))).))..(((((.(((…))).)))))..(((((((..(((…..)))…)).)))))…………….
RS 1 seq UCAAUUCUUCGGGGCGAGGUGAAAUUCCUCACCGACGGUGAUAGUCCGUGAGUGCGUUAGCACUGAUUUGGUGAAAUUCCAAAACCGACAGUAUAGUCUGGAUGGGAGAAGGAUAGU
RS 1 dot …..((.(((.((.((((…….)))).))..))).))….((((.(((((….))))).))..))…..(((((…(((((……))).)).)))))……….
RS 2 seq AUAUUUCUUCAGGGCGAGGUGUAAUUCCUCACCGGUGGUGAUAGUCCACGAGUCGAAAGAUUGAAUCGGUGAAAUUCCGAUACCGACGGUUAUAGUCCGGAUGGGAGAAGAGUAUU
RS 2 dot .((((.((.(..((.((((…….)))).)).).)).)))).((..(((.((((….)))).)))..))..((((.((.(((((…….))).)))).))))………
RS 3 seq UUUUACCUUCAGGGCGAGGCGAAAUUCCUCACCGGUGGUGAAAGCCCACGAGCUCCAAGAGCAUGAUCUGGUGGAAUACCAGAGCCGACGGUAUAGUCCGGAUGAAAGAAGGCUGAU
RS 3 dot (((((((.((..((.((((…….)))).)))).)))))))…..((.((((…)))).)).(((((((…))))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table