Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002595 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA002595
Gene: ADRA1D
MFE: -30.129
ENS: 0.899
Length: 80.
Predicted Ligands:
zmp-ztp - 10/20
fluoride - 4/20
cobalamin - 2/20
 RS: URS0002332175_1701573
MFE: -32.617
Ligand: zmp-ztp
Species: Paraburkholderia piptadeniae ZMP/ZTP riboswitch
 RS: URS0000BF7203_12908
MFE: -17.667
Ligand: fluoride
Species: unclassified sequences Fluoride riboswitch
 RS: URS0002324E8C_1112204
MFE: -30.226
Ligand: zmp-ztp
Species: Gordonia polyisoprenivorans VH2 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002595 URS0002332175_1701573 URS0000BF7203_12908 URS0002324E8C_1112204
Length 80. 78. 82. 79.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.899 - - -
MFE -30.129 -32.617 -17.667 -30.226
Ligands - zmp-ztp fluoride zmp-ztp
Gene ADRA1D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 4.007 9.004
Length SE - 4. 4. 1.
Lev Distance - 18. 19. 21.
UBS 6. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 2. 1. 2. 0.
H 3. 3. 3. 3.
BL 3. 1. 1. 2.
BR 1. 1. 1. 3.
UN 0.050 0.103 0.134 0.114

Sequences

Field Description
UTR seq + 25 ccugccggccgcucguucugugccccggcccggccaccgacggccgcgcguugagATGACTTTCCGCGATCTCCTGAGCG
UTR dot + 25 …(((((.(((…….)))..))))).(((((……)))))(((.(.(((((………..)))))..).)))
RS 1 seq AUGCGUUCGCGCAACUGGCGCUCGAUCGAGGUGGGCCACCACCGGGGAACGCGAACCACGAGCACGCUCGCGUUCCAC
RS 1 dot …((.((((((…..))))..)).)).(((((….)))))..(((((((((………….)))))))))..
RS 2 seq CUGUUACCCGGGAAUGAGGUCUCCCAUGGUAGUGUAAUAUUUACCAGAACCGCUUAUGACAGCUGAUGGCUUCUGCAUUGUG
RS 2 dot …(((((.((((……..))))..))))).((((…))))((((((((((……)))….)).)))))…….
RS 3 seq CCUCGGCAGUGCGACUGGCGCAGCCGGAAUCGACCGGCAAGGAGCACGUUCGAAGACAUCGUCCGCCUGGGUGUCGAUC
RS 3 dot ..(((((.((((…..)))).)))))..((((.((((…..)).)).)))).((((((………))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table