Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002793 Similarity: 0.976 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA002793
Gene: AFM
MFE: -18.742
ENS: 0.875
Length: 118.
Predicted Ligands:
FMN - 20/20 - 20/20


 RS: URS0000C09E10_1276221
MFE: -20.817
Ligand: FMN
Species: Spiroplasma diminutum CUAS-1 FMN riboswitch (RFN element)
 RS: URS0000AB5708_195102
MFE: -30.734
Ligand: FMN
Species: Clostridium perfringens str. 13 FMN riboswitch (RFN element)
 RS: URS0000AB18AE_451756
MFE: -30.734
Ligand: FMN
Species: Clostridium perfringens CPE str. F4969 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002793 URS0000C09E10_1276221 URS0000AB5708_195102 URS0000AB18AE_451756
Length 118. 120. 118. 118.
Similarity - 0.976 0.973 0.973
Ensemble Norm 0.875 - - -
MFE -18.742 -20.817 -30.734 -30.734
Ligands - FMN FMN FMN
Gene AFM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 6.003 6.003
Length SE - 4. 0. 0.
Lev Distance - 24. 35. 35.
UBS 5. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 0. 0.
H 4. 4. 5. 5.
BL 1. 1. 1. 1.
BR 1. 3. 2. 2.
UN 0.254 0.292 0.305 0.305

Sequences

Field Description
UTR seq + 25 guuacuuuuuuacugauaaugugaaagaaugauauaaaaacuugauuuuccucaacaacauuacuuucuuuuguaaaugugguuucuacaaagATGAAACTACTAAAACTTACAGGTT
UTR dot + 25 ((((.((((((((…….)))))))).))))……..((((……))))…..((((……..))))..((((((((………))))))))……………
RS 1 seq GAGUAUUUUCGGGGCAAGGUUAGAUUCCUUACCGAUGGUAAAAGUCCAUGAGCUAAUAAAACAGCAUGAUUCAGUGAAAUUCUGAAACCGACGGUACAGUCCGGAUGAGAGAAAAUACCC
RS 1 dot …((((.((((…((((…….)))).)))).))))………..(((……..)))….(((((…….))))).(((((……))).))…………….
RS 2 seq AAAAGUCUUCAGGGCGGGGUGUGAGUCCCCACCGGCGGUAAAGCCCGCGAGCUAGUUUUUAGCAUGAUUCGGUGAAAUUCCGAGGCCGACAGUAUAGUCUGGAUGAAAGAAGAUGAGU
RS 2 dot …………((.((((…….)))).)).((((……))))..((((…..))))….(((((…….))))).(((((……))).))…………….
RS 3 seq AAAAGUCUUCAGGGCGGGGUGUAAGUCCCCACCGGCGGUAAAGCCCGCGAGCUAGUUUUUAGCAUGAUUCGGUGAAAUUCCGAGGCCGACAGUAUAGUCUGGAUGAAAGAAGAUGAGU
RS 3 dot …………((.((((…….)))).)).((((……))))..((((…..))))….(((((…….))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table