Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002802 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA002802
Gene: AFP
MFE: -12.601
ENS: 0.888
Length: 72.
Predicted Ligands:
fluoride - 9/20
cobalamin - 3/20
homocysteine - 3/20
 RS: URS0000E5FD6F_7159
MFE: -19.594
Ligand: aminoglycoside
Species: Aedes aegypti (yellow fever mosquito) putative aminoglycoside riboswitch / attI site
 RS: URS0000BE9B59_518634
MFE: -11.309
Ligand: fluoride
Species: Bifidobacterium breve DSM 20213 Fluoride riboswitch
 RS: URS0000BE5567_537937
MFE: -12.117
Ligand: fluoride
Species: Bifidobacterium longum subsp. infantis CCUG 52486 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002802 URS0000E5FD6F_7159 URS0000BE9B59_518634 URS0000BE5567_537937
Length 72. 72. 70. 70.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.888 - - -
MFE -12.601 -19.594 -11.309 -12.117
Ligands - aminoglycoside fluoride fluoride
Gene AFP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.004 2.006
Length SE - 0. 4. 4.
Lev Distance - 20. 16. 16.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 1. 1.
H 1. 1. 1. 1.
BL 1. 1. 1. 1.
BR 2. 1. 1. 1.
UN 0.222 0.236 0.157 0.143

Sequences

Field Description
UTR seq + 25 uccauauugugcuuccaccacugccaauaacaaaauaacuagcaaccATGAAGTGGGTGGAATCAATTTTTT
UTR dot + 25 ………((.((((((((((………………………..))))).))))).))…….
RS 1 seq GGAGCAGCAACGAUGUUACGCAGCAGGGCAGUCGCCCUAAAACAAAGUUAGAUGCUUUGCUGUGCGCACAAA
RS 1 dot ………….(((..((((((((((((.((……………..)))))))))))))).)))….
RS 2 seq CUGGGAUUCGGCGAUGGGACCCGCCUGAACUUGUUUCGAACCGCACACUGCUGAUAGUUCCUACACACGA
RS 2 dot ..(((((((((((.((………………………..)).))))))..)))))………
RS 3 seq UAAGGAACCGGCGAUGGAACCCGCCUGAACUCGUUUCGAACCGCACACUGCUGAUAGUUCCUAUACACGA
RS 3 dot ..(((((((((((.((………………………..)).)))))…))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table