Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002803 Similarity: 0.975 Similarity: 0.974 Similarity: 0.965
UTR: 5HSAA002803
Gene: AFP_0
MFE: -23.682
ENS: 0.952
Length: 125.
Predicted Ligands:
FMN - 16/20
preQ_1 - 1/20
glucosamine - 1/20
 RS: URS0000D945DF_1797196
MFE: -25.565
Ligand: FMN
Species: Actinobacteria bacterium RBG_13_35_12 FMN riboswitch (RFN element)
 RS: URS0000ABC112_947828
MFE: -21.752
Ligand: preQ_1
Species: Lactobacillus rhamnosus MTCC 5462 preQ1-II (pre queuosine) riboswitch
 RS: URS0000AB7177_469616
MFE: -24.704
Ligand: FMN
Species: Fusobacterium mortiferum ATCC 9817 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002803 URS0000D945DF_1797196 URS0000ABC112_947828 URS0000AB7177_469616
Length 125. 126. 125. 125.
Similarity - 0.975 0.974 0.965
Ensemble Norm 0.952 - - -
MFE -23.682 -25.565 -21.752 -24.704
Ligands - FMN preQ_1 FMN
Gene AFP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 5.031 16.002
Length SE - 1. 0. 0.
Lev Distance - 32. 34. 42.
UBS 4. 5. 5. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 2.
ILR 0. 0. 0. 1.
H 3. 4. 3. 4.
BL 0. 1. 2. 0.
BR 1. 1. 1. 2.
UN 0.328 0.254 0.504 0.288

Sequences

Field Description
UTR seq + 25 acuaguuaacaggcauugccugaaaagaguauaaaagaauuucagcaugauuuuccauauugugcuuccaccacugccaauaacaaaauaacuagcaaccATGAAGTGGGTGGAATCAATTTTTT
UTR dot + 25 ………(((((…)))))………………….(((((((…….)))))))((((((((((………………………..))))).)))))……….
RS 1 seq GCAAAUUUUCAAGGAUAGGUGAAAUUCCUUACCGGCGGUUAAAGUCCGCAACCCUGCUUUGCACGGCAGGCUGAUUUAGUGAAAUUCUAAGACCGACAGUUACAGUCUGGAUGGGAGAAAAUUUUU
RS 1 dot ……………..(((((……))))).((((…….))))…((((((……))))))((.((((((………………………)))))).))………..
RS 2 seq AAAAGUAAACUGAAAACAUUGUAAGAACUAUUAACUGAAUCGGAACCGCCCCGCGCGCUUCCACGACGAUACUUAUUUCCUUUGAUCGUCGUUAUUACUGGCAAAGCCACAAAGGAGAAACAAUA
RS 2 dot …………………………………..((((.(((…..))).))))((((((((.(………..)))))))))……((((…))))…………….
RS 3 seq UUUUAUCUUCAGGGCAGGGUGAGGUAACAAUUCCCGACCGGUGGUUAUAGUCCACGAGAAUUUUUUAAUUCUGAUUUGGUGAAAUUCCAAAACCGACAGUAUAGUCUGGAUGGAAGAAGAAAAGA
RS 3 dot …………((..(((………….)))..)).((((…….)))).((((((….))))))…………(((((…(((((……))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table