Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA002811 Similarity: 0.990 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA002811
Gene: AFTPH
MFE: -5.006
ENS: 0.793
Length: 57.
Predicted Ligands:
unknown - 16/20
glutamine - 4/20

 RS: URS0000E605B4_1282363
MFE: -17.692
Ligand: unknown
Species: Asticcacaulis sp. YBE204 sul1 RNA
 RS: URS0000E60855_1294143
MFE: -18.729
Ligand: unknown
Species: Pseudomonas denitrificans ATCC 13867 nhaA-I RNA
 RS: URS0000E6082B_1505936
MFE: -26.592
Ligand: unknown
Species: Mesorhizobium sp. ORS3428 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA002811 URS0000E605B4_1282363 URS0000E60855_1294143 URS0000E6082B_1505936
Length 57. 58. 55. 56.
Similarity - 0.990 0.985 0.985
Ensemble Norm 0.793 - - -
MFE -5.006 -17.692 -18.729 -26.592
Ligands - unknown unknown unknown
Gene AFTPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9. 3.015
Length SE - 1. 4. 1.
Lev Distance - 12. 14. 19.
UBS 2. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 2.
ILR 1. 1. 2. 1.
H 1. 1. 1. 1.
BL 0. 1. 0. 0.
BR 0. 1. 0. 1.
UN 0.228 0.241 0.218 0.107

Sequences

Field Description
UTR seq + 25 guguaaauuaauuauuugaaagcaacugaacaATGGAGCCAGACATCATTCGAATGT
UTR dot + 25 …………((((((((…..(((………..)))……)))))))).
RS 1 seq AAUGGACCUGGUCUGAGCUGCCGGGUGGCUAUUCCGGGCGCCGAUCCCUCGGACAACG
RS 1 dot ……….(((((((……((((.((…..)).))))…..)))))))….
RS 2 seq GGGUGUCUGCUGCAAGGGUGGCGAGACAGGUCAAUGCGCAGGUCGGGCCGCCGCG
RS 2 dot ………..((…((((((..(((..((……))..)))..)))))))).
RS 3 seq AUCGGACCCGGUGGAAAUCCGGGUGGCGCUUCCGGCCGCCAAUCCGCCGGACCAAC
RS 3 dot …((..((((((((……((((((…….))))))..)))))))).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table