Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003039 Similarity: 0.975 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA003039
Gene: AGTPBP1
MFE: -23.281
ENS: 0.980
Length: 113.
Predicted Ligands:
TPP - 11/20
glycine - 4/20
SAM - 2/20
 RS: URS0000C1D15C_1522368
MFE: -48.604
Ligand: TPP
Species: Modestobacter caceresii TPP riboswitch (THI element)
 RS: URS0000C391B6_315405
MFE: -22.239
Ligand: preQ_1
Species: Streptococcus gallolyticus preQ1-II (pre queuosine) riboswitch
 RS: URS000232A9F4_58049
MFE: -20.236
Ligand: cobalamin
Species: Colwellia sp. MT41 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003039 URS0000C1D15C_1522368 URS0000C391B6_315405 URS000232A9F4_58049
Length 113. 114. 113. 111.
Similarity - 0.975 0.975 0.973
Ensemble Norm 0.980 - - -
MFE -23.281 -48.604 -22.239 -20.236
Ligands - TPP preQ_1 cobalamin
Gene AGTPBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.016 0.018 7.005
Length SE - 1. 0. 4.
Lev Distance - 30. 34. 28.
UBS 8. 9. 8. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 1. 2. 1. 3.
H 2. 3. 2. 2.
BL 3. 4. 3. 2.
BR 3. 2. 3. 2.
UN 0.230 0.105 0.097 0.162

Sequences

Field Description
UTR seq + 25 acguugcccgggaugcggacagguuccgccgccuccagcgccccauccugagccgauuaucugcaauuaugaaaugaaguaacucaagATGAGCAAGTTAAAAGTGATACCAG
UTR dot + 25 .(((((…(((..(((((…..)))))..))).)))))…((((.((((….(((.((.((………)).))))))))).))))………………….
RS 1 seq GUGUCGACCCGCGGGAGCCUCGCGUACCGAGGCUGAGAGGGCGGCAGGACCGGCCGCUGACCGUUCGCACCUGACCCGGUUAGCACCGGCGUAGGGAGGAACCUCGAUGACGGA
RS 1 dot .(((((.(((.(…(((((((…..)))))))..).))))))))…((((..((((((((.((……))..)))))))).))))((.(((……)))))……..
RS 2 seq UGUGCUAUACUUUUAAGCGUUGUGAAAACAACCCUUGACGCUUAGUUCCCUUUCGUCAAGCAUAUUAGAGACGUGAAGAAUUGUCGCUCUUUAACGUUAAAGGAGAAAAAAUU
RS 2 dot .(.((((…..(((((.(((((….))))).)))))….)))).)(((((…..(((…(((((((.((((…….))))))))))).))))))))……….
RS 3 seq UUUUUGUGUUAUGAAGAUGGUGAAAAUCCAUCGCUGUGCCCGCAACUGUAAAUGAAGUGAUAUUCAGUUUUCCGAUAAAUAUCGCCUCAAAGUCAGAUAGCUAACCAAAAA
RS 3 dot …(((((.((((..(((((…….)))))..))))..)))))(((….(((.((((((((..(((….))).)))))))).)))….)))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table