Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003041 Similarity: 0.950 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA003041
Gene: AGTPBP1_0
MFE: -66.420
ENS: 0.904
Length: 191.
Predicted Ligands:
cobalamin - 9/20
FMN - 5/20
Mn2+ - 5/20
 RS: URS0000D9CE5C_1985169
MFE: -77.743
Ligand: FMN
Species: Hydrogenophaga sp. IBVHS1 FMN riboswitch (RFN element)
 RS: URS00023323FA_943830
MFE: -63.647
Ligand: cobalamin
Species: Rhodopseudomonas sp. R-45977 Cobalamin riboswitch
 RS: URS00023322C5_928856
MFE: -70.914
Ligand: cobalamin
Species: Tropicibacter sp. CECT 7557 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003041 URS0000D9CE5C_1985169 URS00023323FA_943830 URS00023322C5_928856
Length 191. 192. 191. 191.
Similarity - 0.950 0.949 0.948
Ensemble Norm 0.904 - - -
MFE -66.420 -77.743 -63.647 -70.914
Ligands - FMN cobalamin cobalamin
Gene AGTPBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5. 8.
Length SE - 1. 0. 0.
Lev Distance - 64. 65. 65.
UBS 17. 17. 16. 17.
BS 0. 1. 0. 0.
ILL 3. 3. 2. 4.
ILR 2. 2. 1. 3.
H 5. 5. 5. 4.
BL 7. 6. 6. 5.
BR 8. 7. 9. 9.
UN 0.120 0.083 0.131 0.115

Sequences

Field Description
UTR seq + 25 gggaugcggacagguuccgccgccuccagcgccgccgccgcagcugccgccgccgccgccuccgccucgccugccaccgggguuuguaugaaaacaccgggcggcgggcggcgagggauccgccgugauccagauuaucugcaauuaugaaaugaaguaacucaagATGAGCAAGTTAAAAGTGATACCAG
UTR dot + 25 (((..(((((…..)))))..)))…((((.((.((.((….)).)).)).)).))((.((((..(((((((.((.((((((……)))).)).)).)))))))))))))(((((……))))).(.((((((….((((……..))))….)))))).)……………….
RS 1 seq CAGCGUUCUCAGGGCGGGGUGAGAUUCCCCACCGGCGGUGAUGGUGGCGUGGCGACACGACCACACGAGUGCCGCGAGCGCCCAUGUGCCGAUUCAUUUCGGUGCCUGGGGUCAGCAGACCCGGUGAGAUCCCGGGACCGACGGUAAGGUGUCUGGCAACAGGCUCCAGAGUCCGGAUAAAAGAGAGCGCGA
RS 1 dot ..((((((((..((.((((…….)))).))((((.(..((((((((((….)))).)))).))).))))((..((.((((.(((((((……))))))).))))))..))…(((((.(….)))))).(((((…..((.(((((….))))).))…))).))……))))))))..
RS 2 seq GAUAGCGUCUUUUGCGAUGGUCCUUCCGCGUGGAAGGUGAAUAGGGAAGCCGGUUUGAGGCCGGCGCUGCCCCCGCAACUGUAAGCGACGAGCCCGCGCCGGUGCCACUGGGAAUUCUUCAGAAUUCUUGGGAAGGCGGCAACAGGCUUUGACUCGCAAGCCAGGAGACCUGCCAUCACGAACUGUGCUUU
RS 2 dot …(.((((……)))).)((((((….))))))…….((..((((((.((.(((((.((((……………)))).)).))))).)))))).)).((((((((((….))))))))))((.((((((..(.(((((……..))))).)..).)).))).))…………..
RS 3 seq UCUAUAUAGUGGUGCUUCGGUUCUUCCGGGAUGCCCUGGGAGCUGAGAGGGAAGCCGGUGAAAAUCCGGCGCUGCCCCCGCAACUGUUAGUGGUGAGCAAUGCCGGAAAAGCCACUGGGACAAGGGUCCUGGGAAGGUCGGCGGCGCGUGAAGCCACGAGUCAGGAGACCUGCCGCAAGCAUGGAAUAACC
RS 3 dot ……..((..(.(((((((((..(((((….)))))))))))).)).)..))(((((….(((((((.(((.(((((……..)))).).))).)))))))…..)))))((((….))))((((.(((((..((((.((((….)))).))).)..))))).)).))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table