Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003219 Similarity: 0.962 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA003219
Gene: AIP
MFE: -54.323
ENS: 0.759
Length: 150.
Predicted Ligands:
cobalamin - 8/20
TPP - 5/20
FMN - 4/20
 RS: URS0000D8CD64_1732019
MFE: -61.275
Ligand: FMN
Species: Xanthomonas sp. Mitacek01 FMN riboswitch (RFN element)
 RS: URS0000C2AEEB_1894
MFE: -62.255
Ligand: TPP
Species: Streptomyces aureofaciens TPP riboswitch (THI element)
 RS: URS0000C68025_359131
MFE: -64.855
Ligand: TPP
Species: Streptomyces rubellomurinus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003219 URS0000D8CD64_1732019 URS0000C2AEEB_1894 URS0000C68025_359131
Length 150. 148. 149. 148.
Similarity - 0.962 0.957 0.956
Ensemble Norm 0.759 - - -
MFE -54.323 -61.275 -62.255 -64.855
Ligands - FMN TPP TPP
Gene AIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 6. 5.
Length SE - 4. 1. 4.
Lev Distance - 42. 52. 51.
UBS 15. 16. 15. 14.
BS 0. 0. 0. 0.
ILL 2. 1. 4. 3.
ILR 5. 5. 5. 4.
H 2. 2. 2. 2.
BL 9. 9. 8. 8.
BR 5. 7. 6. 6.
UN 0.040 0.027 0.040 0.041

Sequences

Field Description
UTR seq + 25 gcuucugcccucaaccaaaauggcgcuagcucggaagcugccgaggugcuaggaguugccgaagcaaguccggaagcuaccgagcgaguccggaaguugccgaaagggagcagcggggaaggaggATGGCGGATATCATCGCAAGACTCC
UTR dot + 25 (((.((.((((((((…..(((.(((.((((((.((((.(((.((((((.((…..))..))))..))))).)))).)))))).))))))…))))…..)))))).)))……((((..(.(((……..))).)..))))
RS 1 seq GAAUGUCUUCGGGGCGGGGUGGAAGUCCCCACCGGCGGUAGGCGCGGCGACGCGUGAGCCCGCGAGCGCUGCCGGCUUUGUCGGCGGGUCAGCAGAUCCGGUCCAAGUCCGGAGCCGACGGUCAGAGUCCGGAUGCGAGAAGACGACC
RS 1 dot ….((((((.(((((((.((((.((.(((.(((((((.((.(((((((.(.((((….)))).))))))).).))))))))).)))…))…)))).)))..)))).)))..)))((((….((((….)).))….))))
RS 2 seq AAACUGACACGCGGGAGCUUGGACCCACCAGGCUGAGAGUGCGCAUGUCGACGGUACGCCAGGCGAGCGACAGGCUGACCGUCGAGGGGGCGCUGACCGCCGGAACCUGUCCGGGUAAUGCCGGCGUAGGGAGUAUCGGCCAUGCCGCC
RS 2 dot ..(((..(((((.((.((((((((…((.(((.(..(((((.(.(.((((((((..(((.(……..).)))..)))))))).)).)))))..).)))))…..))))))))….)).)))).)..)))..((((…))))..
RS 3 seq AAACUGACACGCGGGAGCUUGGACCCACCAGGCUGAGAGUGCGCAUGUCGACGGUACGCCACAGGACUGACGGCGAACCGUCGAGGGGGCGCUGACCGCCGGAACCUGUCCGGGUAAUGCCGGCGUAGGGAGUAUCGGCCAUGCCGCC
RS 3 dot ..(((..(((((.((.((((((((…((.(((.(..(((((.(.(.((((((((.((((………..)))).)))))))).)).)))))..).)))))…..))))))))….)).)))).)..)))..((((…))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table