Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003228 Similarity: 0.964 Similarity: 0.961 Similarity: 0.959
UTR: 5HSAA003228
Gene: AIP_0
MFE: -50.928
ENS: 0.880
Length: 137.
Predicted Ligands:
homocysteine - 9/20
cobalamin - 6/20
glycine - 3/20
 RS: URS0000D88B37_28094
MFE: -52.742
Ligand: glycine
Species: Burkholderia caryophylli Glycine riboswitch
 RS: URS00022E5528_219649
MFE: -50.025
Ligand: glycine
Species: Paraburkholderia unamae Glycine
 RS: URS0000C139DB_1804984
MFE: -52.262
Ligand: homocysteine
Species: Burkholderia sp. OLGA172 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003228 URS0000D88B37_28094 URS00022E5528_219649 URS0000C139DB_1804984
Length 137. 137. 137. 137.
Similarity - 0.964 0.961 0.959
Ensemble Norm 0.880 - - -
MFE -50.928 -52.742 -50.025 -52.262
Ligands - glycine glycine homocysteine
Gene AIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 10.006 8.
Length SE - 0. 0. 0.
Lev Distance - 41. 46. 50.
UBS 15. 14. 13. 14.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 4. 2. 2. 2.
H 4. 3. 3. 3.
BL 8. 7. 8. 7.
BR 6. 4. 5. 5.
UN 0.036 0.073 0.117 0.036

Sequences

Field Description
UTR seq + 25 accaaaauggcgcuagcucggaagcugccgaggugcuaggaguugccgaagcaaguccggaagcuaccgagcgaguccggaaguugccgaaagggagcagcggggaaggaggATGGCGGATATCATCGCAAGACTCC
UTR dot + 25 .(((…)))..((.((((((.((((.(((.((((((.((…..))..))))..))))).)))).)))))).))(((.(..(((.((….)).)))..).)))..((((..(.(((……..))).)..))))
RS 1 seq UUUUCGCACUCUGGAGAGCGGCAGUAGUCCGUCGGCCCCGGCCGAGGCAGGCUGCCCACCGAAGGGGCGCGCGUUCGACGGCAGCCAUGGCAUGCCGGCAGCGCAAUCUCUCAGGUACCGAGGACAGAGGGGUCAUG
RS 1 dot ….(((.((((((…(.((((((.(.((.(((((….))))))))..))))))).))..))))))).(((((.(.(((((((….)).))))).)))))).(((((((..((…….)).)))))))….
RS 2 seq GUCCGCAACUCUGGAGAGCGGCAGUAGAACGGGCGGCGGCGGAUCGUACCCCCACGCGUUCAGGCUGCCCACCGAAGGGGCGCGCGCCAGUCGCAGCAAGGCGCAAUCUCUCAGGUACCGAGGACAGAGGGGCCAUG
RS 2 dot …(((..((.(((…(.((((((.(((((.(.((.((.(…….))))).).)))))..))))))).))).))..))).(((((………..)))))………(((.((………)).)))…
RS 3 seq GUCUUCGAGGAGCGUUGCGACGGGUACCGCGAAUCAGCAUAUUCGCCGGCCGCCCGCCAGGCUCGGAGGCUUCAAUCGGAGGGCUCGGACGCGCAUAGCGCUUUCCCAGCCACCGCAUCGAACCGCGCUCACGUCAA
RS 3 dot ((((((…((((.(((.(.(((((.((((((((……)))))).))..)))))))))))))))))))(((.(((((..((((.(((.((((…))))..))).)))).))).)).)))..(((….)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table