Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003346 Similarity: 0.982 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA003346
Gene: AKR1B1
MFE: -34.242
ENS: 0.819
Length: 99.
Predicted Ligands:
SAM - 5/20
zmp-ztp - 5/20
glycine - 3/20
 RS: URS0000ABD06B_408172
MFE: -33.526
Ligand: guanidine
Species: marine metagenome Guanidine-I riboswitch
 RS: URS0000C83FA6_1286171
MFE: -34.333
Ligand: SAM
Species: Peptoclostridium acidaminophilum DSM 3953 SAM riboswitch (S box leader)
 RS: URS0000C4842F_999541
MFE: -41.687
Ligand: zmp-ztp
Species: Burkholderia gladioli BSR3 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003346 URS0000ABD06B_408172 URS0000C83FA6_1286171 URS0000C4842F_999541
Length 99. 99. 99. 100.
Similarity - 0.982 0.979 0.979
Ensemble Norm 0.819 - - -
MFE -34.242 -33.526 -34.333 -41.687
Ligands - guanidine SAM zmp-ztp
Gene AKR1B1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 9.002 0.001
Length SE - 0. 0. 1.
Lev Distance - 23. 24. 27.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 4. 3. 2. 4.
H 1. 1. 1. 1.
BL 5. 5. 3. 5.
BR 2. 2. 3. 2.
UN 0.061 0.141 0.020 0.090

Sequences

Field Description
UTR seq + 25 acgggcuauuuaaagguacgcgccgcggccaaggccgcaccguacugggcgggggucuggggagcgcagcagccATGGCAAGCCGTCTCCTGCTCAACA
UTR dot + 25 ..((((…….(((.(((.((….((((.(((.((..(((.((((((….))))))…)))..)).))).))))..)))))..)))))))….
RS 1 seq GGCGGAGAAACCUAGGGUUCCGAUCCCGUCAGGGAUGCCUGGUCCGAGAGGUUUCGGUCGGCACAACCGGCUGCACUGAGGGACAAAAGCCCGGGAGAC
RS 1 dot ……….(((.(((((….((((.(((((.(.(((.(((((((..(….)..))))….))))))).).))))))))….))))))))….
RS 2 seq UUCUUAUCAAGAGUGGCGGAGGGACUGGCCCUGUGAAGCCCGGCAACCUGCAGUAAUGCAAGGUGCCAAAUCCAGCGGUUUUCGGCCGGAAGAUGAGAU
RS 2 dot .(((((((…..((((.(((…..(((((((.((…..(((.(((((((….)))).))))))…))))).))))))).))))…))))))).
RS 3 seq CAGCCCCUGCGUGACUGGCGAUAGAACCCUCGGGUUCAAGGUGGAGCAUCCCACCGUGAAGCGCAGGGCGUCGUUUUUGCCGUUCGCCUGGGCAGCCGUU
RS 3 dot ..((((..(((.(((.(((((..((.((((..(.((((.(((((……))))).)))).)..))))..))….)))))))))))..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table