Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003581 Similarity: 0.954 Similarity: 0.953 Similarity: 0.949
UTR: 5HSAA003581
Gene: ALDH18A1
MFE: -56.158
ENS: 0.925
Length: 173.
Predicted Ligands:
Mg2+ - 8/20
cobalamin - 4/20
Mn2+ - 4/20
 RS: URS0000C2BC16_1223523
MFE: -63.298
Ligand: Mg2+
Species: Streptomyces mobaraensis NBRC 13819 = DSM 40847 M-box riboswitch (ykoK leader)
 RS: URS000074D49C_1802
MFE: -57.858
Ligand: Mg2+
Species: Mycobacterium farcinogenes M-box riboswitch (ykoK leader)
 RS: URS0000AB6134_886882
MFE: -53.762
Ligand: FMN
Species: Paenibacillus polymyxa SC2 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003581 URS0000C2BC16_1223523 URS000074D49C_1802 URS0000AB6134_886882
Length 173. 174. 172. 173.
Similarity - 0.954 0.953 0.949
Ensemble Norm 0.925 - - -
MFE -56.158 -63.298 -57.858 -53.762
Ligands - Mg2+ Mg2+ FMN
Gene ALDH18A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 8.003 2.
Length SE - 1. 1. 0.
Lev Distance - 58. 57. 68.
UBS 16. 17. 16. 15.
BS 0. 0. 0. 0.
ILL 4. 5. 4. 5.
ILR 3. 4. 5. 3.
H 4. 4. 4. 4.
BL 5. 6. 5. 5.
BR 5. 5. 3. 5.
UN 0.098 0.075 0.047 0.116

Sequences

Field Description
UTR seq + 25 acugacguaacgucaucgugcgggacguggacggaagaaaaaagagagugagcgagcgccggaaucagcccggcguggagugcggacccgcgguagugccagggggcgaaggcggcggugauacuuugguuagugaccacaucgcagcATGTTGAGTCAAGTTTACCGCTGTG
UTR dot + 25 .((..(((.(((((.((….)))))))..)))..))……….(((..(..(((((((…….))))))).)..))).(.(((.((((…))).).))))….((((((((((.(((……..(((((((((……)))).).))))))))))))))))).
RS 1 seq GAGGCACCUCGUUCGGUGAGGCGUCUUCACGGACACAGGCCACUGACCCCACGACGUCGAGAGACGCCCAGGUUCAGGACAGAUCUCCCCGGCCUAAGGGGUGAUCCCAAGUGGCUGCCCGGACCGAGGGAUUACGCCGUGGAGUGCCAAAGCUCUGACGAGUUGGGGUGAGCC
RS 1 dot ..(((.(…((((.((((((…))))))))))…)))).((((.((…(.((((….)))))…)).))))….((((.((((…….)))).))))……((((((((.(((((..(((….((..(((….)))..)))))..)).))).)))).))))
RS 2 seq AUCGCGCUUCGUUAGGUGAGGCUCCUACACGAACACAGGCCACUGAUCCGACGACGUCGAGAGACGCCCAGGGUUAGGACAGGUCUUCCCGGCCUAAGGGAUGACCCGAAGUGGCUUCCCGCCCUGGUGGGACACGUCGUGUAGUGCCAAAGCUCUGGUGAGGAAGUGCCCG
RS 2 dot …..(((((((((((…….)))).))))…..)))(.(((((((…(.((((….)))))…))))))))…((((.((((…….)))).))))((..(..((((((((((..(((.((.(((……..)))))…)))..)))).))))))..)))
RS 3 seq AAGAUCCUUCGGGGCGGGGCGAAACUCCCCACCGGCGGUGAUGACAUGUUUGUGAAUCGCUUCUGUGAACACAGCAUGGCUUAGUCCGUGACCCGGAUGCUGAACAAUCAGCAGAAGGUGGACCUGGUGUAAUUCCGGGACCGACAGUAUAGUCUGGAUGGGAGAAGGAUACG
RS 3 dot …..((.((((((.((((…..)))))).)))).))……((((.(((((..((((….)))).)))))))))…..((((…(((….((((((….))))))…)))))))…((((..((((.(..(.(((……))).)..).))))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table