Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003585 Similarity: 0.967 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA003585
Gene: ALDH18A1_0
MFE: -36.713
ENS: 0.968
Length: 131.
Predicted Ligands:
cobalamin - 9/20
FMN - 5/20
TPP - 3/20
RS: URS0000BE2D4F_631454
MFE: -53.026
Ligand: TPP
Species: Phyllobacteriaceae bacterium AMV1 TPP riboswitch (THI element)
RS: URS000231BB03_1449976
MFE: -51.570
Ligand: cobalamin
Species: Kutzneria albida DSM 43870 Cobalamin riboswitch
RS: URS0002315B8D_1352941
MFE: -40.406
Ligand: cobalamin
Species: Streptomyces niveus NCIMB 11891 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003585 URS0000BE2D4F_631454 URS000231BB03_1449976 URS0002315B8D_1352941
Length 131. 130. 131. 131.
Similarity - 0.967 0.964 0.963
Ensemble Norm 0.968 - - -
MFE -36.713 -53.026 -51.570 -40.406
Ligands - TPP cobalamin cobalamin
Gene ALDH18A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 20.005 15.001
Length SE - 1. 0. 0.
Lev Distance - 39. 40. 43.
UBS 9. 11. 7. 11.
BS 0. 0. 0. 0.
ILL 4. 2. 1. 3.
ILR 2. 1. 3. 2.
H 3. 4. 4. 3.
BL 2. 2. 1. 5.
BR 2. 3. 0. 1.
UN 0.053 0.062 0.122 0.084

Sequences

Field Description
UTR seq + 25 aucgugcgggacguggacggaagaaaaaagagagugagcgagcgccggaaucagcccggcguggagugcggacccgcgauacuuugguuagugaccacaucgcagcATGTTGAGTCAAGTTTACCGCTGTG
UTR dot + 25 ((((((.((..(((…………………..((..(((((((…….)))))))…)))))..))))))))….(((((…)))))…((((((..((.((……)).)).))))))
RS 1 seq GGCGCAUCCAAGGGGAGCCCCGCCGAAGAGGGGUUGAGAGGCCGCUGGCGCUUCAUCCGAAAGCGCGGCGCGGCGACCCUUCGAACCUGAUCCAGGUCACGCUGGCGAAGGGAUGGAAGGCAUUUCCGGC
RS 1 dot (((((.(((….)))))…)))…((((((((…..((((((.(((((((….))).)))).).)))))))))))))..(((((…)))))…(((((…..(((((…..))))))))))
RS 2 seq UCGGACGUCCUACUCUAUGGUCCGAAAUCGAGCCGCGGUGCAGGGAAGCUGGUGCGAGUCCAGCGCGGUCCCGCCACUGUGACCGGGUGCAGCCCCGGGAGUCAGACACCGGCCGUGGCCGUCACGUGUUG
RS 2 dot ((((((………….))))))……..(((((((..((((.(((((…….)))))….))))..))))))).(((((……)))))……(((((((((….))))….))))).
RS 3 seq CACAUGUAUGCUCAAGUCUGUUGUCGCCGCAGGAGAAUCCGGUGGAAAUCCGGAACUGUCCCGCAACGGUGUGCUGUGGUGCGCUAUGCGCGCCCGCGAGUCCGAGUACCUGCCGACGACGCAUCCGGUUC
RS 3 dot ((((.(((((((…….((((.((..((((…..(((((…….))))).))))..)))))))))))))))))((((((…))))))..(((.((.((.((….))))))..)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table