Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003591 Similarity: 0.966 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA003591
Gene: ALDH18A1_1
MFE: -42.856
ENS: 0.932
Length: 131.
Predicted Ligands:
TPP - 10/20
FMN - 4/20
cobalamin - 4/20
 RS: URS0000D996D2_1122214
MFE: -52.405
Ligand: TPP
Species: Martelella mediterranea DSM 17316 TPP riboswitch (THI element)
 RS: URS00019EEEBF_570505
MFE: -48.946
Ligand: TPP
Species: Methylobacterium bullatum TPP
 RS: URS0000C1CC5C_1736249
MFE: -46.065
Ligand: TPP
Species: Methylobacterium sp. Leaf93 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003591 URS0000D996D2_1122214 URS00019EEEBF_570505 URS0000C1CC5C_1736249
Length 131. 130. 131. 131.
Similarity - 0.966 0.966 0.965
Ensemble Norm 0.932 - - -
MFE -42.856 -52.405 -48.946 -46.065
Ligands - TPP TPP TPP
Gene ALDH18A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 14.003 14.003
Length SE - 1. 0. 0.
Lev Distance - 42. 39. 40.
UBS 11. 11. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 5. 4. 3. 3.
H 4. 3. 3. 3.
BL 4. 3. 2. 2.
BR 1. 1. 1. 1.
UN 0.038 0.115 0.092 0.092

Sequences

Field Description
UTR seq + 25 gcgagcgccggaaucagcccggcguggagugcggacccgcgguagugccagggggcgaaggcggcgguggugaggaagauacuuugguuagugaccacaucgcagcATGTTGAGTCAAGTTTACCGCTGTG
UTR dot + 25 (((.(((((((…….)))))))….)))…(((..(((…)))..)))((….)).(((((((((((…(((.(..(.(((.((((…..)))))))..)..).)))…))))))))))).
RS 1 seq CGCAUUCACCCGGGGGGUCCCGACAAGGGGCUGAGAUUCUGAUGGCCGGACCGGCAGGUCCGUGCAGCGCAGUGACCCGAUGAACCUGAUCCAGUUCAUACUGGCGUAGGGAUGGUGUUCGGGCCGCGCG
RS 1 dot ……….(((((((((((…..))))))….)))))…((((((((….)))))).)).((((.(.(.(((((((..((((..(((((….)))))..))))..))….))))))))))).
RS 2 seq GGGUGUUCCAGGGAGAUCCCCGUCAAGGGGCUGAGAAACCGAUGAGCGUGGACCACGGGUCCGUGCGGCGCGGAAAUCCUUCGAACCUGAACCGGCUCAUACCGGCGUAGGGAUUGGACCGUGGGUUUUCU
RS 2 dot .(((.((((((……((((…..))))))).))))))…..(((((((((…)))))))))…..(((((((((((((.((((..((((……))))..))))..)))))….)))))))).
RS 3 seq GGGUGUUCCAGGGAGAUCCCCGUCAAGGGGCUGAGAAACCGAUGAGCGUGGACCACAAGUCCGUGCGGCGCGGAAAUCCUUCGAACCUGAACCGGCUCAUACCGGCGUAGGGAUUGGACCGUGGGUUUUCC
RS 3 dot .(((.((((((……((((…..))))))).))))))…..((((((((…..))))))))…..(((((((((((((.((((..((((……))))..))))..)))))….)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table