Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003801 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA003801
Gene: ALDH8A1
MFE: -26.428
ENS: 0.815
Length: 78.
Predicted Ligands:
SAM - 12/20
homocysteine - 3/20
fluoride - 2/20
 RS: URS0000BE3B3D_657308
MFE: -20.072
Ligand: fluoride
Species: Gordonibacter pamelaeae 7-10-1-b Fluoride riboswitch
 RS: URS0000ABB223_411684
MFE: -22.287
Ligand: SAM
Species: Hoeflea phototrophica DFL-43 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D91D5B_1817764
MFE: -24.787
Ligand: homocysteine
Species: Candidatus Muproteobacteria bacterium RIFCSPHIGHO2_01_FULL_65_16 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003801 URS0000BE3B3D_657308 URS0000ABB223_411684 URS0000D91D5B_1817764
Length 78. 77. 78. 78.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.815 - - -
MFE -26.428 -20.072 -22.287 -24.787
Ligands - fluoride SAM homocysteine
Gene ALDH8A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 8.001 8.013
Length SE - 1. 0. 0.
Lev Distance - 19. 19. 20.
UBS 4. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 1. 4. 2.
H 2. 1. 1. 1.
BL 0. 1. 1. 1.
BR 0. 1. 0. 2.
UN 0.064 0.143 0.103 0.179

Sequences

Field Description
UTR seq + 25 gggacaaccugagugcucagucguaaagaggaaaggcagaauuuuuccuugcuATGGCTGGAACAAACGCACTTTTGA
UTR dot + 25 ((…..)).(((((((((((((((..(((((((((…..)))))))))..)))))))))…….))))))….
RS 1 seq AAUGCCUGCGGGAAUGAGGUUCUCCCUAAGCCGUUUCAAGGCUUGAACCGCGUAAAGCUGAUGACUUCUGCAAACGG
RS 1 dot ……((((((((((.(((((…..(((((…….)))))))))).)))…………)))))))…..
RS 2 seq AGCUUAUCCCGUGGUGAUUUGGCCGACCGGCUUGCAGCCACGUUAAACAAGUCGCUAAAAGGUCGGGUUGCAAAACCG
RS 2 dot .((….((((((((((((((…(((.((((…))))..)))…))))))))))……))))..))…….
RS 3 seq CUCUCCGAGGAGCGUUGCGACAGGGAUGCCCUGCCAGGCUCGGACAGAACGUCAGUCAAACAACGGCGCUCCAAUCAU
RS 3 dot ……..(((((((((.(((…((((..(((((……)).)))..)))).)))……)))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table