Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003868 Similarity: 0.988 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA003868
Gene: ALG13
MFE: -13.975
ENS: 0.941
Length: 59.
Predicted Ligands:
cobalamin - 7/20
fluoride - 5/20
glutamine - 4/20
 RS: URS0000DB3D74_1610493
MFE: -24.175
Ligand: cobalamin
Species: Tessaracoccus flavus Cobalamin riboswitch
 RS: URS0000D68530_498214
MFE: -12.575
Ligand: fluoride
Species: Clostridium botulinum A3 str. Loch Maree Fluoride riboswitch
 RS: URS0000ABA1D9_550540
MFE: -20.366
Ligand: cobalamin
Species: Ferrimonas balearica DSM 9799 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003868 URS0000DB3D74_1610493 URS0000D68530_498214 URS0000ABA1D9_550540
Length 59. 59. 60. 57.
Similarity - 0.988 0.987 0.986
Ensemble Norm 0.941 - - -
MFE -13.975 -24.175 -12.575 -20.366
Ligands - cobalamin fluoride cobalamin
Gene ALG13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 3.013 4.017
Length SE - 0. 1. 4.
Lev Distance - 14. 16. 13.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 0. 0.
H 2. 2. 2. 3.
BL 2. 0. 1. 1.
BR 0. 1. 1. 1.
UN 0.237 0.220 0.350 0.105

Sequences

Field Description
UTR seq + 25 ggcccuugcgaucagggcuugaggaacccgcgccATGAACAATCATCAGCTGGAACTGG
UTR dot + 25 ((((((…….))))))……..(((.((.((((….))))..)))))……
RS 1 seq UCCGGUGCGAACCCGGAACUGACGCGCAACCGUAUCCGGCCCAUGGGCCGGGAGUCGGA
RS 1 dot (((((…….)))))…………(((..(((((((….)))))).)..))).
RS 2 seq AGAAUUUUGGUCGAUGGAGUUCGCCAUUAAAUGCGUAGAGUUAAUGACUCCUACAAAUAG
RS 2 dot …….(((.(((……))))))……..((((((((…))))).)))……
RS 3 seq UCCGGUGAGAAUCCGGAGCUGGCGCGCAACGGUAUGAGGCCCACGCCUUAAGCCCGA
RS 3 dot (((((…….)))))((……))…(((.((((((….)))))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table