Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003869 Similarity: 0.989 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA003869
Gene: ALG13_0
MFE: -16.962
ENS: 0.995
Length: 65.
Predicted Ligands:
cobalamin - 10/20
fluoride - 8/20
unknown - 2/20
 RS: URS0000C1E884_1470557
MFE: -19.054
Ligand: fluoride
Species: Streptomyces sp. Tu 6176 Fluoride riboswitch
 RS: URS000232FBA7_1203605
MFE: -15.214
Ligand: cobalamin
Species: Propionibacterium sp. oral taxon 192 str. F0372 Cobalamin riboswitch
 RS: URS0000C66180_477641
MFE: -25.426
Ligand: cobalamin
Species: Modestobacter sp. 42H12-1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003869 URS0000C1E884_1470557 URS000232FBA7_1203605 URS0000C66180_477641
Length 65. 64. 64. 67.
Similarity - 0.989 0.989 0.988
Ensemble Norm 0.995 - - -
MFE -16.962 -19.054 -15.214 -25.426
Ligands - fluoride cobalamin cobalamin
Gene ALG13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 6. 3.
Length SE - 1. 1. 4.
Lev Distance - 13. 12. 11.
UBS 5. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 2. 2. 1.
BR 0. 1. 2. 1.
UN 0.169 0.109 0.156 0.164

Sequences

Field Description
UTR seq + 25 auauccggcccuugcgaucagggcuugaggaacccgcgccATGAACAATCATCAGCTGGAACTGG
UTR dot + 25 …(((((((((…….))))))…)))..(((.((.((((….))))..)))))……
RS 1 seq GACGGAGACGGCGAUGAGGCUCGCCCUUGACCGCACACCCCGUGCUGAUGGCCUCUGUGAACGA
RS 1 dot ..(((.((.(((((……))))).))..)))((((..((((….))))….))))…..
RS 2 seq GGGAAUCCGGUCGAAAUCCGGGACUGUCGCGCAACGGUGAGGCAUCACGCCAAGUCCGAAAACC
RS 2 dot (.((.(((((…….)))))….)).)….((((..(((…..)))..).)))……
RS 3 seq AGGGAAGCCGGUGCGAGCCCGGCGCGGUCCCGCCACUGUGACCCCACCUCGGGGGAGCCAGACACCU
RS 3 dot .((((.(((((…….)))))….))))….((((..((((…..))))..)).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table