Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA003878 Similarity: 0.968 Similarity: 0.965 Similarity: 0.964
UTR: 5HSAA003878
Gene: ALG13_1
MFE: -33.752
ENS: 0.961
Length: 126.
Predicted Ligands:
FMN - 8/20
cobalamin - 4/20
SAM - 3/20
 RS: URS0000AB728E_1003237
MFE: -66.905
Ligand: Mn2+
Species: Azospirillum amazonense Y2 yybP-ykoY manganese riboswitch
 RS: URS0000ABA14E_655812
MFE: -26.451
Ligand: FMN
Species: Aerococcus viridans ATCC 11563 FMN riboswitch (RFN element)
 RS: URS0000D89B29_1903952
MFE: -21.759
Ligand: glycine
Species: Photobacterium proteolyticum Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA003878 URS0000AB728E_1003237 URS0000ABA14E_655812 URS0000D89B29_1903952
Length 126. 125. 126. 126.
Similarity - 0.968 0.965 0.964
Ensemble Norm 0.961 - - -
MFE -33.752 -66.905 -26.451 -21.759
Ligands - Mn2+ FMN glycine
Gene ALG13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.009 11.001 13.004
Length SE - 1. 0. 0.
Lev Distance - 39. 43. 44.
UBS 7. 8. 9. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 3.
ILR 1. 0. 2. 3.
H 4. 4. 4. 2.
BL 0. 1. 2. 0.
BR 1. 3. 2. 1.
UN 0.222 0.128 0.198 0.286

Sequences

Field Description
UTR seq + 25 acggauuuccgccucccucacagaaggcagucacugcaacgugcguggccucaguugcgucauauccggcccuugcgaucagggcuugaggaacccgcgccATGAACAATCATCAGCTGGAACTGG
UTR dot + 25 .(((….)))……………((((…))))..((((((((((((((…………..((((((…….)))))))))))…))))).))))………(((……))).
RS 1 seq CCGCCCAUCAUUGGGGAGUAGCCGCCCGCCGAUUUUGAGCGGGCGCCGCGUCAACAGACUUGGGCCCCGCCGGUGCUUCACCGGUGCGGCCCAUGGCGCGUGCGACCGAUCCGCCCUGCGCGGAU
RS 1 dot …((((….))))………(((((((….)).)))))((((((((((…….((((((.((((((((…)))))))).))))))))))))).)))….((((((…..))))))
RS 2 seq AAAUGUCUUCAGGGCAGGGUGCGAGUCCCGAUCGGCGGUAAAGUCCGCGAAAUACCAGCUGCAAUAGGUGAUUGAACUAGUGGAAUUCUAGUACCGACUGUUACAGUCAGGAUGGAAGAAGCGUAU
RS 2 dot …(((((…)))))(((…….)))…..((((……))))……(((((((.(((((..(…(.(((((…….))))).))..))))).))))…..)))………..
RS 3 seq AUGAAGACAGCAGGAGAGUGGCAAGAUACGUUAUUGUAUCCGCCCGCCGAAGAAGUAAGCAGUUUAACCAACCAGAAUUAUUCUGUUAUUAAGUUGUAAAUCUUUCAGGCACCGCAAUGUUAAUUC
RS 3 dot ……………….(((..((((((….)))))).))).((((((((…..(((((((((…..(((((…)))))…)))))))))…)))))..)))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table