Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004193 Similarity: 0.987 Similarity: 0.983 Similarity: 0.981
UTR: 5HSAA004193
Gene: AMELX
MFE: -14.905
ENS: 0.831
Length: 93.
Predicted Ligands:
glycine - 10/20
TPP - 6/20
zmp-ztp - 1/20
 RS: URS0000C61D36_1469144
MFE: -42.686
Ligand: glycine
Species: Streptomyces thermoautotrophicus Glycine riboswitch
 RS: URS0000C1D641_12908
MFE: -29.498
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS0000ABC67F_422289
MFE: -23.940
Ligand: TPP
Species: Beggiatoa sp. PS TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004193 URS0000C61D36_1469144 URS0000C1D641_12908 URS0000ABC67F_422289
Length 93. 93. 92. 92.
Similarity - 0.987 0.983 0.981
Ensemble Norm 0.831 - - -
MFE -14.905 -42.686 -29.498 -23.940
Ligands - glycine zmp-ztp TPP
Gene AMELX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 4. 3.
Length SE - 0. 1. 1.
Lev Distance - 17. 21. 23.
UBS 6. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 2. 1. 2.
H 3. 3. 2. 3.
BL 1. 1. 1. 2.
BR 0. 1. 1. 1.
UN 0.075 0.108 0.087 0.065

Sequences

Field Description
UTR seq + 25 aaaggaucaagcaucccugaguuucaaacagaaacuugcacugaauacauucaaagaaccaucaagaaATGGGGACCTGGATTTTATTTGCCT
UTR dot + 25 …((((…..))))..(((((((…..)))))))(((…((((.(((((…..((((……))))…..)))))..)))))))..
RS 1 seq GAAUCCCGAGUGGGAGAGACCCGCCGCGUCAGGCGGGCGCCGAAGGAGCAACCACCCCCGGAAGCUUUCCGGCACAGCUACCGCUCGGCGGAG
RS 1 dot …((((….))))….((((((……))))))((((((.(((((……..((((((…))))))….))).))..))))))…
RS 2 seq AAACGACCAUACGACUGACGGAAGUGGAGCAACCACAUGGAGUGUGGCCGGACGUAAACCGCGUCCUCUUGCCGACCGUCUGGGCACACUGA
RS 2 dot ……((((………….((((…..))))))))((((((.(((((((……(((……)))….))))))).))))))..
RS 3 seq UUUAUCUGCUAGGGGUGUCCAUUAGGACUGAGAAUAAACCCUUUGAACCUGAUCCAGAUCAUGCUGGCGCAGGAAAGCAUGUUUAUACUUGU
RS 3 dot …((((…..))))((((….)))).(((.((((((.((((…((((..((((……))))..))))))))…)))))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table