Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004299 Similarity: 0.975 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA004299
Gene: AMTN
MFE: -18.225
ENS: 0.959
Length: 114.
Predicted Ligands:
TPP - 17/20
glycine - 1/20
FMN - 1/20
 RS: URS0000C79A0B_411475
MFE: -35.526
Ligand: TPP
Species: Flavonifractor plautii ATCC 29863 TPP riboswitch (THI element)
 RS: URS0000C0D164_1121324
MFE: -24.704
Ligand: glycine
Species: Peptoclostridium litorale DSM 5388 Glycine riboswitch
 RS: URS0000C35D0B_1703387
MFE: -30.461
Ligand: TPP
Species: Anaerolineae bacterium SM23_ 63 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004299 URS0000C79A0B_411475 URS0000C0D164_1121324 URS0000C35D0B_1703387
Length 114. 113. 114. 114.
Similarity - 0.975 0.972 0.972
Ensemble Norm 0.959 - - -
MFE -18.225 -35.526 -24.704 -30.461
Ligands - TPP glycine TPP
Gene AMTN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.005 11.001 8.001
Length SE - 1. 0. 0.
Lev Distance - 29. 34. 35.
UBS 4. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 3.
ILR 1. 2. 3. 2.
H 2. 2. 3. 3.
BL 0. 2. 0. 0.
BR 1. 2. 0. 0.
UN 0.254 0.186 0.219 0.289

Sequences

Field Description
UTR seq + 25 aauuuuucaccagaguaaacuugagaaaccaacuggaccuugaguauuguacauuuugccucguggacccaaagguagcaaucugaaacATGAGGAGTACGATTCTACTGTTTT
UTR dot + 25 ………………(((((((…((….))..)))))))(((((((……(((((((…………………..))))))).)))))))………..
RS 1 seq AACUGAAUGCUGGGGGGCCGGAUGGAAUCCGGCUGAGAGUUAGGCUGUUCUGCCUAUGACCCAUGGAACCUGUUGGGUAAUGCCAUCGUAGGGAGCGCGGUUCACGCCGUUUU
RS 1 dot ……..(((….((((((((…))))))))…)))..((((((.((.(((((((((((……….))))……..))))))).)).))))))………..
RS 2 seq AAGAAGGGUAUAGGAGAGAGCUUGCUACAGAUCAGCAGGCCGCCGAAGGGACAAGUCUUGUUUUUCCCAAAAAAGCAAGGUGAAAUUCUCAGGCAAAAGGACUAUAUCUGGACA
RS 2 dot ……………….(((((((…….))))))).(((..((((…..((((((((((…..))))))))))…..))))..)))….(..(…….)..).
RS 3 seq UUACAUAACACGGGGAGCCCAUAACCCAUGGGCUGAGAGGAGGGAAGGAAGGCCCUCGACCCGAAGAACCUGAUCCGGGUAAUGCCGGCGGAGGGAUGGUUAUUACGAAAUGCU
RS 3 dot ……………(((((((…..)))))))…..(((((……..)))))((((….(..(((…((((……))))…)))..)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table