Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004300 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA004300
Gene: AMTN_0
MFE: -21.218
ENS: 0.971
Length: 123.
Predicted Ligands:
TPP - 9/20
glycine - 4/20
guanidine - 3/20
 RS: URS0000C1C11A_1395587
MFE: -33.733
Ligand: glycine
Species: Paenibacillus sp. MAEPY2 Glycine riboswitch
 RS: URS0000C76A43_1286631
MFE: -62.019
Ligand: zmp-ztp
Species: Sphaerotilus natans subsp. natans DSM 6575 ZMP/ZTP riboswitch
 RS: URS00000CF4F9_859656
MFE: -49.042
Ligand: glycine
Species: Ralstonia solanacearum CFBP2957 Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004300 URS0000C1C11A_1395587 URS0000C76A43_1286631 URS00000CF4F9_859656
Length 123. 124. 123. 123.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.971 - - -
MFE -21.218 -33.733 -62.019 -49.042
Ligands - glycine zmp-ztp glycine
Gene AMTN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 6. 7.003
Length SE - 1. 0. 0.
Lev Distance - 35. 38. 39.
UBS 8. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 2. 2. 2. 4.
H 2. 2. 2. 1.
BL 3. 1. 5. 4.
BR 1. 2. 2. 1.
UN 0.089 0.073 0.089 0.033

Sequences

Field Description
UTR seq + 25 gaaggguaaaauuuuucaccagaguaaacuugagaaaccaacuggaccuugaguauuguacauuuugccucguggacccaaagguagcaaucugaaacATGAGGAGTACGATTCTACTGTTTT
UTR dot + 25 …((((……..((((.((.(((((((((((…((….))..)))))))……….)))))).))))))))…(((((.((((……………..)))))))))…..
RS 1 seq UGAUAGCGAGCGGGAGAGUCCUGGGCAUGCCGAGUAAAAAGGCAGCUGUCGGGCACCGAAGGAGCAAGCUGCUACGCACCCGGCGCAGUGGUUAAUCUCUCAGGUAAAUGUACCAUCGUUGGAC
RS 1 dot …..((((((((…..((((.((..((((((……………)))).))))..))))…..))))).)))..((((((..(((((……………….)))))))))))..
RS 2 seq GCCCGACCACGCAACUGGCGUUCAAGGCCCGCAUCGGGCCGAGGUGGGCAACCACCGGGGAGCGUGGUCGCCGCAGGCGCAUCGGCUUGCGGCGGUUUCUUGCCGUGCGCCUGGGCAGCCCGA
RS 2 dot …(((((((((..((.(.((…..((((((.(((…))).))))))….))).))..)))))))))((.((((((((.((((……………))))))))))))))……..
RS 3 seq CGGCUGCACUCUGGAGAGCGGCGCCGCGCCAUCAUCGCAGGCGCCCACCGAAGGGGCUCACGGAACCGCCGGCGCGUUGCGCCGCUUCCCAAUCUCUCAGGUACCAAGGACAGAGGGGCCACC
RS 3 dot .((((.(.((((((.(((((((((((((((….(((..(((.(((……))))))..)))…….))))))..))))))))).)))…………………))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table