Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004342 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA004342
Gene: AMZ2
MFE: -34.889
ENS: 0.859
Length: 86.
Predicted Ligands:
guanidine - 9/20
GMP - 4/20
SAM - 3/20
 RS: URS0000D66ADB_12908
MFE: -31.827
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D68045_12908
MFE: -34.940
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C49464_1881858
MFE: -30.398
Ligand: SAM
Species: Nesterenkonia sp. PF2B19 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004342 URS0000D66ADB_12908 URS0000D68045_12908 URS0000C49464_1881858
Length 86. 86. 87. 87.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.859 - - -
MFE -34.889 -31.827 -34.940 -30.398
Ligands - GMP GMP SAM
Gene AMZ2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7.002 11.002
Length SE - 0. 1. 1.
Lev Distance - 27. 26. 25.
UBS 7. 7. 7. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 2. 2. 2.
H 2. 2. 3. 2.
BL 4. 2. 3. 5.
BR 4. 3. 2. 4.
UN 0.047 0.058 0.092 0.092

Sequences

Field Description
UTR seq + 25 ggcguaaggggcguggcgccagugggcguggcguggcgcagugcgaagggacgcggugcgcATGCAAATAATACGGCACTCCGAAC
UTR dot + 25 (((((……….)))))..(.((.(((.(((((((((.((((……)))).)))))……….)))).))).)).)..
RS 1 seq CCUCACGCGGGAAGCUCUGACGCGCGGCCCACACUCCUGGUCGCCGGGACCACGCCGAGCCACUGGCGAGACCGACCCGCGCGGUG
RS 1 dot ..(((.((…..))..)))(((((((……((((((((.(((((…….))).)).))))).)))……)))))))…
RS 2 seq UGGCGGGGCAGAGGCCAAGAACCACGUCCCGCACCGACGGGCACUGAAGGGGCGUGGGGGAGCCAGUGGUGCGACCGGCUACCGCUA
RS 2 dot ((((………))))….(((((((((.((((….))…))..)))))))))((.((((.((……)).)))).))….
RS 3 seq CAACCAUCCAGAGCGGCUGAGAGAUCUGGCUCGACGACGCCGCAGCAACCCGGGAGAGCCGGGUGCUAACGCCAGGAGCGAUGGAGG
RS 3 dot …….(((((.(……..).)))))(((.(((.(.(((((((.((((((…..)))))))))…))..)).))).).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table