Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004354 Similarity: 0.969 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA004354
Gene: AMZ2_0
MFE: -33.297
ENS: 0.748
Length: 127.
Predicted Ligands:
TPP - 6/20
cobalamin - 6/20
FMN - 5/20
 RS: URS0000AB88B5_561180
MFE: -35.684
Ligand: TPP
Species: Bifidobacterium gallicum DSM 20093 TPP riboswitch (THI element)
 RS: URS0000BF9297_1262780
MFE: -23.160
Ligand: glucosamine
Species: Clostridium sp. CAG:221 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB5A53_392500
MFE: -36.268
Ligand: glycine
Species: Shewanella woodyi ATCC 51908 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004354 URS0000AB88B5_561180 URS0000BF9297_1262780 URS0000AB5A53_392500
Length 127. 126. 127. 130.
Similarity - 0.969 0.967 0.967
Ensemble Norm 0.748 - - -
MFE -33.297 -35.684 -23.160 -36.268
Ligands - TPP glucosamine glycine
Gene AMZ2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.009 4. 8.002
Length SE - 1. 0. 9.
Lev Distance - 34. 43. 30.
UBS 9. 9. 8. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 3. 1. 2. 5.
H 2. 2. 2. 2.
BL 1. 3. 2. 2.
BR 3. 6. 2. 2.
UN 0.102 0.198 0.102 0.062

Sequences

Field Description
UTR seq + 25 gggcugccgcgggugggugguaucgaggccugucggccaggcccagacauguccguccuuguaaguuaaaagcuuccaugggagccuuccuuccuaaucaagATGCAAATAATACGGCACTCCGAAC
UTR dot + 25 ((((((((((((((………….))))).))))..)))))……((((((……..((((…((.((..((((((……))))))…..)).))…)))))))).))…….
RS 1 seq GGAAUCAAGCAGGGGGGCCUGUGGAGUCAAGCAUUGUGCUUGGUUCAGCAAGCUGAGAUUGGCGUUACGCCUGACCCUUCGAACCUGUUGGUUAGAACCAGUGUAGGGAGCGUUCGCAAUGAAUAU
RS 1 dot .((((((((((.((..((.((……)).)).)).))))))))))……………(((..((((….((((((.((((….)))).))……..)))).)))).)))………
RS 2 seq AACUAAGUUGACGAGGAUGAGAUUUAUCGAAUUUUUUCGGCGGAUAUCUCACGUAAAUAGCACUAGCGUUAAUAAUUAACAAAACUACAAAGUAAUUUGUAGGACAAAUUUAAUUAUGUGCAAUCUA
RS 2 dot ……(((.(((….((((((((.(((((….)))))..)).))))))))).))).((((……..((((((((…..(((((((….)))))))…….))))))))))))……
RS 3 seq GGACGAGCCUCUGGAGAGACUGUGAGCAGCUAAGUGUUCGUCAACUUAACUGUCACACAGCGCCGAAGGCGAAAGUGUUAGCCCAAAUGGCAAACGCGAAACGCUCAGGCAAAAGGACAGAGGAGAGGAU
RS 3 dot .((((((((((((………….)))…)).)))))))..(((..(((((.(…..(((…((((…(((((.(((…..))).)))))….))))..)))….))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table