Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004366 Similarity: 0.970 Similarity: 0.970 Similarity: 0.967
UTR: 5HSAA004366
Gene: ANAPC10
MFE: -29.534
ENS: 0.953
Length: 123.
Predicted Ligands:
TPP - 6/20
SAM - 6/20
cobalamin - 2/20
 RS: URS0000DB1736_1797937
MFE: -50.029
Ligand: fluoride
Species: Elusimicrobia bacterium GWD2_63_28 Fluoride riboswitch
 RS: URS0000C14A46_1660161
MFE: -40.183
Ligand: TPP
Species: Comamonadaceae bacterium SCN 68-20 TPP riboswitch (THI element)
 RS: URS0000ABA87F_754027
MFE: -32.119
Ligand: TPP
Species: Treponema phagedenis F0421 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004366 URS0000DB1736_1797937 URS0000C14A46_1660161 URS0000ABA87F_754027
Length 123. 124. 122. 121.
Similarity - 0.970 0.970 0.967
Ensemble Norm 0.953 - - -
MFE -29.534 -50.029 -40.183 -32.119
Ligands - fluoride TPP TPP
Gene ANAPC10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 3.029 3.006
Length SE - 1. 1. 4.
Lev Distance - 38. 38. 38.
UBS 6. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 3. 2. 1.
H 3. 3. 4. 4.
BL 1. 0. 1. 1.
BR 1. 1. 1. 0.
UN 0.350 0.258 0.180 0.273

Sequences

Field Description
UTR seq + 25 gucauugagcugcgacccuuguucaacgccguuggcgaagccagcugcuggaggugccgagaaucugaguuucggcaagcagccagaauauuuuaaaaATGACTACACCAAACAAGACACCTC
UTR dot + 25 ….((((((……….))))))..(.((((((…)))))).)((((..(((((((((…….)))))))..))..))))……………………………….
RS 1 seq AUUAAUAACGGCGAUGAUGUCCGCCGCCCCGGCCGCCCGGGGAAACCGCCCGCGAGGCCGUCUGAGGCGCAUAGCGCUUGUUACGGCACGGCCAUAGGCCAGGGCUGAUGACCUCUACCCCCUA
RS 1 dot ……..(((((……..)))))((((((….))))))…..((((((..(((((((((((((((…))))))….))).))))))….))..))))……………….
RS 2 seq GCGCCUGCUCCGGGGUGCACGUAGGAUUAAUUUCCUGGGCGUGCUGAGAUGGCGGACCUGACCGCCGGAACCGCGAACUUGAUCUGGUUAGUACCAGCGUAAGAAGAGCUGCAAUGGAAGAG
RS 2 dot ((((((……)))))).(.(((((……))))).)((((……((((((……))))))….))))..((((..(((((….)))))..))))……………….
RS 3 seq UACCGGUACCGGGGUGCCAAGUGUUUAUCUUGUGCUGAGAUAAUACCCGAAAGUUUUCCGUAUGGAAAACUUAAAACCUGAUCCGGAUAAUACCGGCGGAGGAAGUUAUGAAAAAACUCUA
RS 3 dot ….(((((….)))))..(((.(((((((…..))))))))))….(((((((((….)))))))))….(((…((((……))))…)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table