Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004369 Similarity: 0.920 Similarity: 0.919 Similarity: 0.915
UTR: 5HSAA004369
Gene: ANAPC10_0
MFE: -64.202
ENS: 0.947
Length: 248.
Predicted Ligands:
cobalamin - 17/20
FMN - 2/20
lysine - 1/20
 RS: URS000231E941_272559
MFE: -58.651
Ligand: cobalamin
Species: Bacteroides fragilis NCTC 9343 Cobalamin riboswitch
 RS: URS0000AB5A28_392500
MFE: -61.509
Ligand: FMN
Species: Shewanella woodyi ATCC 51908 FMN riboswitch (RFN element)
 RS: URS000232913A_281093
MFE: -86.841
Ligand: cobalamin
Species: Chlorobium bathyomarinum Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004369 URS000231E941_272559 URS0000AB5A28_392500 URS000232913A_281093
Length 248. 247. 246. 247.
Similarity - 0.920 0.919 0.915
Ensemble Norm 0.947 - - -
MFE -64.202 -58.651 -61.509 -86.841
Ligands - cobalamin FMN cobalamin
Gene ANAPC10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.026 6.020 11.002
Length SE - 1. 4. 1.
Lev Distance - 97. 99. 106.
UBS 16. 13. 16. 15.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 4.
ILR 2. 2. 2. 4.
H 7. 5. 6. 7.
BL 4. 4. 6. 3.
BR 5. 4. 5. 3.
UN 0.052 0.215 0.195 0.097

Sequences

Field Description
UTR seq + 25 gccguuggcgaagccagcugcuggaggugccgagaaucugaguuucggcaagcagccaggucuggaaacuguaacaggacauucaguuaguaaugaugguugcagguugaauagucucgcccuagaucucaccuaacuugcaguaaguaucaagugcuugugugccgauuaaagaacaacuucggauacaaugggaggugucaaggaaacgaauauuuuaaaaATGACTACACCAAACAAGACACCTC
UTR dot + 25 …((((((…))))))..((((..(((((((((…….)))))))..))..))))(((((……….))).))….((((((…(((.((((..(((.(((……))).))).))))))).)))))).(((.(……..).)))((((((.((((………….))))))))))…((((((((………………………………..))))))))
RS 1 seq UAUAUUUGCAGCCGCUUAGGUGAUGCAUACCGGACUUUCUGUUCGUUGCAUAAAAGGGAAUCGGGUGUAAAUCCCGAACAGUGCCCGCUACUGUGAUCCCCCUGCUCUUCUACUGUUGCCAUCAUAAUCGGAAGAAGAUAAGAAAAGCAUUUCUACAUAUACCACUGUCAUAGCCUGUAAAGCAUGACGGGAAGGUAGCUUUUCAAAAAGGGAUAGUCAGGAAACCUGCCGAAGCAGACAUAGAUAA
RS 1 dot …(((((((.(((……..(((((…(((((…..))))).)))))……….))).)))))))…..((((((…..))))))………..((((((.((((((……))).))).))))))…(((((((………..((((.(((((((.((…….)))))))))…)))))))))))…………………((((….))))……….
RS 2 seq GUAAAUUCUCAGGGCGGGGUGAAACUCCCCACCGGCGGUGAUAGCGCUUAAAUUAACCUAAGCCUUAAGCCCGCGAGCGCCCAAAUCAACUUAACAUUGAAGAUGUAAGCUGAUUUGGGGUCAAGCAGAUCUGGUGAACUCUAUCUGAUACAUAUAUAGAACACUCCAGAGCCGACGGUAAUGAACCGUAUUACUCAGAUAACACACUAGUAGUACAGUACUAAGUCCGGAUGAAAGAGAAUAUAA
RS 2 dot …………((.((((…….)))).)).((((…(((.(((((……..))))).)))…))))…..(((((((((.(((.(((((…)))))))).)))))))))(((..((…(((((.(…(((((………..)))))…).))))))).)))(((…..)))((((((((.((……..))))))))))…………………………
RS 3 seq UUCUUUGUCUUUGUAACUGGUGCCGGUUUAAAAGCCGGAGAAUAGGGAAGUACGUGAGAUUCGUACACUGUACCCGCAACUGUUACAACGGUUUGCUUUCGUUCUGUUCGUCGUGGCCACACGACGCCGGAGCGGAGGUUCUCCAGAGUCACUGCGCUUCGAUUUCCGCCCGGAAAUGCGCGGGAAGGCUCUGAAGAGAUAUUUAUCCGUUGAAAGUCAGGAGACCUGCCAGCUACGAUUUGCUCGA
RS 3 dot (((((((.((((..(((((….)))))..)))).)))))))..(((..(((((…….)))))……)))..((((((….)))))).((((((((((((..(((((((….))))))).))))))))))))(((((((((((.((((((….((((((….))))))))))))…)))))))..))))………………((((…))))(.(((……..))).).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table