Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA004373 Similarity: 0.961 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA004373
Gene: ANAPC10_1
MFE: -32.098
ENS: 0.990
Length: 134.
Predicted Ligands:
FMN - 7/20
Mn2+ - 4/20
TPP - 4/20
 RS: URS0000D7BEA5_290109
MFE: -35.304
Ligand: Mn2+
Species: Xenorhabdus innexi yybP-ykoY manganese riboswitch
 RS: URS0000ABBC96_650150
MFE: -25.917
Ligand: glucosamine
Species: Erysipelothrix rhusiopathiae str. Fujisawa glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BE9C6E_1230730
MFE: -25.043
Ligand: glucosamine
Species: Tissierellia bacterium S5-A11 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA004373 URS0000D7BEA5_290109 URS0000ABBC96_650150 URS0000BE9C6E_1230730
Length 134. 134. 133. 133.
Similarity - 0.961 0.961 0.961
Ensemble Norm 0.990 - - -
MFE -32.098 -35.304 -25.917 -25.043
Ligands - Mn2+ glucosamine glucosamine
Gene ANAPC10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.089 6.050 4.012
Length SE - 0. 1. 1.
Lev Distance - 49. 49. 50.
UBS 5. 7. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 0. 1. 0.
H 3. 5. 5. 4.
BL 1. 1. 0. 1.
BR 0. 1. 0. 1.
UN 0.388 0.090 0.165 0.278

Sequences

Field Description
UTR seq + 25 gucauugagcugcgacccuuguucaacgccguuggcgaagccagcugcuggaggugccgagaaucugaguuucggcaagcagccaggucuggaaacuaauauuuuaaaaATGACTACACCAAACAAGACACCTC
UTR dot + 25 ….((((((……….))))))((((…))))..(((.((((((…..((((((((…….))))))))))))))..)))……………………………………….
RS 1 seq CCGUCCCAGUCAUUGGGGAGUAGCCUGUUCCAGAAUAUCUCUGGAAAAUUCGUAUCAACAUGCUCGUUUUAAUAAAACGUGGUACGAAUGCCGAAUCGGUUGGCAAGACCAUAGACAUAUAUAUCACCAUUGGU
RS 1 dot .(.(((((…..))))).)…….(((((((…..))))))).((((((((((…….((((((…))))))))))))))))(((((…..)))))…((((……………….))))
RS 2 seq UUAGGAAUUUAAGCGCCUGGCUCAUAUAGAGCGACGAGGAAAGAGGAGAAUCGAGACUUCGGCGGAUGCCUCUUCGGUUAUAUGGAAUCGUAAGAUAAGGACAAAUUGAACAAAUCCCUUAUCACCCAUAAUC
RS 2 dot .((((……….))))((((…..))))……..((((((….((((….))))……))))))(((((……)))))…(((((((…………….)))))))……….
RS 3 seq AAUCAUUAUAAAGCGCCAGAACCAAAUGGUUGACGAGGGAUGGAGUGAUCGAAAAUUCGGCGGAUGCUCCAAGGGUAUCACAGCCCCAGCACUUAACAAAACUUUUACAGACAAAAAUAGUGCAGUGAGUCUC
RS 3 dot …………..((((……..))))……….(((((((.(((………))).))))))).((((……))))..(((((…………………….)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table